Description :
From Genome Similarity Track
Location :
contig_105:85103- 90160
Transcript NameFunction/comments
g13069.t1hypothetical protein
g13070.t1hypothetical protein

Sequence
5057 bases(100 bases per row)
CCTCGCGGGTCCAGAACGACGCTGAGCGATATCGGTCGCAGCGTGCGAACGTCGCGCAGGACGAAGAAGATCCTGGCGACTACCTTTTCTCGGTTGGTCG
TACGAGCAGTACCGCCAAGCCGAGTGACATGTGGCTGGTCGACTCGGGTGCGACGCAGCACATGACGAGTTCCAAGACGTACATGAGGAACTACAAGACG
ATGGCTCCGGTGGACGTGCATCTCGCGGACGACGGTGTGGTTCAGGCGGTGGGACCGGCGACATTGTCATGTCGATGAAGACGCCGCGCGGCATGAAGAA
GGGTGTGCTCACGAATGTGTGGCATATCCCGAAGCTGTCGCGCAACCTGTTTTCGGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTTCGAGAGC
GACGGGTGCTTCGCGGACAACAAGGGTCTCAAGTGGCAGCTCGGCGCTCGTGAGGGCAAAGGGCTGTTCAAGCTGTGCATGACTCCGATGATGCCTGACG
AGGCCAATGCGGCAAGTTCGAAGGATCGCCAAGGGGACACCACGTCGTACCTCTGGCACCTCCGACTTGGTCACATTGGCCATGGCGGTCTAGACGCCAT
CGTCAAGAAGAGCTACGGTGTTGGCATCGACATGACGTCGGTGAAGCAGTGGGAGCTGTGCGACGGGTGTGCACTCGGCAAGCAAACGCGAGTGAGCTAC
ATGAAGTCGTCCCCGAACCGTGCGAAGCACGTGCTGGAGGTGGTTCACAGCGATGTGTGCGGCCCCATGCAGACGCCAACGTTTGGGGGCAAGCGCTACT
TCGTCACGTTCATCGACGACAAGTCGCACTTCTGCGTCGTGTACTTGCTGAGGAACAAGTCCGAGGTGGCTGCCAAGTTCGCGGAGTTTGTGGCGTTTGC
TGAAACTCAGACCGGCAAGCGCGTGCAGACACTCCGGAGCGACAACGGTGGCGAGTACACTTCCGGCGCGATGGCCAAGTTCTGTGCGGACCGCGGTATC
GTGCAGAAGTTCACTCCGCCGTACACGCCTCAGCTGAACGGAGTGGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATG
CCGGATTGCCCAAGACGTATTGGGGAAGCGGTGATGACGGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCGTCAGCCACGACAAGTCTCCGCACC
AAGTTTGGACGGCAAGAAGCCGCTGCTGCGAACCTGAAAGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTC
GGTCGGTGCGCTGTCGGTTCCTGGGGTACTCGGAGCACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCA
GTTCATGGAAGACGTCTTCGACAGTGGGAGACGTGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAG
TCGGATGAAGACGACAACGAAGAAGAGGAAGAAGAGGAAGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCACTGG
AGGAAGTCACGGAGGTTCCAAGTGCCAAGCGGTATGCGTCGCAGAGTCGACACCAGACGCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTT
CGAAGCTGCGTACGTCGTGGATTCAGTGGGAGAAATGCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGAC
TCGGAGTGTGACTCGCTGCTCAAGAACGACACGTGGGATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGG
AGAACCAAGCTGGAGAGATTGAGCGGTTCAAGGCGCGACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGT
GGCCAAGTTCACGTCCATCCGGATCGTACTGAGTCTGGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTG
CTGGACGAAGACATCTACATGGCACAGCCGGATGGCTATGTGGACGAAGACCACCCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGC
AGTCGCCGCGCATGTGGAACCAGACCATCGACGACTTCATGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGG
CCAAGACATGATCTTCGTGGCGCTGTACGTCGACGACTTGGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGG
TTTGAGATGACGGACCTCGGCGAGCTGGAGTACTTCCTCGGGATGGAGATCAAGAACGACCGGCTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTC
AAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCT
GCCAGCATGAAGACACGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGT
GGGAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTC
GAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGCACAAGCGGCTACGCGTTCA
TGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGGCGCTGTCTTCAACGGAGCAGAGTACATGGCGCTATCGGAGGCGACACAA
GAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGG
CCAAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGT
TTCGACAACGACATGCTGGCGGACATGATGACGAAGGCATCCTGCAACGCAGTTCAGTGTGCTTCGGAGCAAGCTCGGGATCCAAGGTGCAATCGCTGTC
GAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCT
GTGTTGACGGGACGCTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTAC
AAGATGGGCATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTA
GAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAACCGACCAAAGCCTTTTCTTCGCAAGATGATCGACAACG
ACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTGTCGCGGCTGCCAACAAGGGAAAATGGTCCAGAAGCCGTTCCCAAGCAA
CCGTGACAAGCGCCGCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCTCTGGGTGGCAGCAAGTATCTGCTGCTG
ATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTCACGAAGGTGCAGACGC
AGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCA
AACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCATAACGCGCCATTCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTG
GACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCATTCGAGATCGTGT
ACAAGTCCAAGCCAAGTGTGAAGCACATGCTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGG
GACCGCAATCATTCCTGTGTTGACGGGACGCTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGT
ACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTTAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGA
GAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAGCCTTTTGGTTATG
AGCCCAAGCCCCGTCTTCCCTGCCCAAGACCAAGACCCCGACTACGCCTTCGCCATGGACGCCACCCCGACCGCGACCGCCCGCATCAACAAGTTCAACG
GAACCAACTTCCACACGTGGAAGTTCAAGATGCAGATGGTGCTCGAGGAGCGCGAACTGTGGGAAGTGACGAGTGGGGAAGTGAAGCTGGAGCACTGCAC
GACCACGGCGGATCAAGCGACGTTCAAGAGGAAGTCGCGTAAGGCGCTGGCGATCATCTGTCTCGCGATGGAGGACTCGCAGCTGCCGCTGGTTCGCTCG
GCCAAGGACGCGCATGATGCATGGTCAAGACTGGAAGGACACTTCGAGAAGAAGAGT