Description :
From Genome Similarity Track
Location :
contig_105:85102- 90043
Transcript NameFunction/comments
g13583.t1hypothetical protein
g13584.t1hypothetical protein

Sequence
4941 bases(100 bases per row)
CAGCGTGCGAACGTCGCGCAGGACGAAGAAGATCCTGGCGACTACCTTTTCTCGGTTGGTCGTACGAGCAGTACCGCCAAGCCGAGTGACATGTGGCTGG
TCGACTCGGGTGCGACGCAGCACATGACGAGTTCCAAGACGTACATGAGGAACTACAAGACGATGGCTCCGGTGGACGTGCATCTCGCGGACGACGGTGT
GGTTCAGGCGGTGGGACCGGCGACATTGTCATGTCGATGAAGACGCCGCGCGGCATGAAGAAGGGTGTGCTCACGAATGTGTGGCATATCCCGAAGCTGT
CGCGCAACCTGTTTTCGGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTTCGAGAGCGACGGGTGCTTCGCGGACAACAAGGGTCTCAAGTGGCA
GCTCGGCGCTCGTGAGGGCAAAGGGCTGTTCAAGCTGTGCATGACTCCGATGATGCCTGACGAGGCCAATGCGGCAAGTTCGAAGGATCGCCAAGGGGAC
ACCACGTCGTACCTCTGGCACCTCCGACTTGGTCACATTGGCCATGGCGGTCTAGACGCCATCGTCAAGAAGAGCTACGGTGTTGGCATCGACATGACGT
CGGTGAAGCAGTGGGAGCTGTGCGACGGGTGTGCACTCGGCAAGCAAACGCGAGTGAGCTACATGAAGTCGTCCCCGAACCGTGCGAAGCACGTGCTGGA
GGTGGTTCACAGCGATGTGTGCGGCCCCATGCAGACGCCAACGTTTGGGGGCAAGCGCTACTTCGTCACGTTCATCGACGACAAGTCGCACTTCTGCGTC
GTGTACTTGCTGAGGAACAAGTCCGAGGTGGCTGCCAAGTTCGCGGAGTTTGTGGCGTTTGCTGAAACTCAGACCGGCAAGCGCGTGCAGACACTCCGGA
GCGACAACGGTGGCGAGTACACTTCCGGCGCGATGGCCAAGTTCTGTGCGGACCGCGGTATCGTGCAGAAGTTCACTCCGCCGTACACGCCTCAGCTGAA
CGGAGTGGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGGATTGCCCAAGACGTATTGGGGAAGCGGTGATGAC
GGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCGTCAGCCACGACAAGTCTCCGCACCAAGTTTGGACGGCAAGAAGCCGCTGCTGCGAACCTGAA
AGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCGGTGCGCTGTCGGTTCCTGGGGTACTCGGAGCAC
GAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACGTCTTCGACAGTGGGAGACGTGACT
ACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGACAACGAAGAAGAGGAAGAAGAGGA
AGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCACTGGAGGAAGTCACGGAGGTTCCAAGTGCCAAGCGGTATGCG
TCGCAGAGTCGACACCAGACGCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTCGTGGATTCAGTGGGAGAAATGC
CGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTCGCTGCTCAAGAACGACACGTGGGA
TGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAGATTGAGCGGTTCAAGGCGCGA
CTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCCATCCGGATCGTACTGAGTCTGG
CTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCTACATGGCACAGCCGGATGGCTA
TGTGGACGAAGACCACCCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATGTGGAACCAGACCATCGACGACTTC
ATGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCCAAGACATGATCTTCGTGGCGCTGTACGTCGACGACT
TGGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTACTTCCT
CGGGATGGAGATCAAGAACGACCGGCTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAA
GCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACACGATGAAGAACGTGCCGTATCGG
AGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGTGGGAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGA
CGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGCTA
TTCGGATGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAG
CAGCGGACGGTGGCGCTGTCTTCAACGGAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGG
CGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACCAAGCACATC
GACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGTTTCGACAACGACATGCTGGCGGACATGATGACGAAGGC
ATCCTGCAACGCAGTTCAGTGTGCTCCGGACCAAGCTCGGGATCCAAGGTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGC
AGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACACTGATGATGGGACGCGGGACACTG
ATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAGTCGCTGACTGGCTGAA
GCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATC
AATCACTTTGCATTTTGCCATCAACCGACCAAAGCCTTTTCTTCGCAAGATGATCGACAACGACATGATCAAGGACGTGAAGGCACCTTCCAAGTCGAGT
GGACCAAGCGTGTGTCGCGGCTGTCAGCAAGGGAAAATGGTCCAGAAGCCGTTCCCAAGCAACCGTGACAAGCGTCGCTACGACACGTTCGAGCTGCTCC
ACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCTCTGGGTGGCAGCAAGTATCTGCTGCTGATCGTGGATGAAGCCAGCGGATGCATGAAGGGGTTCTG
CCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGA
GCTCGTGAGTTCGCGACCAACTCGCTGAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGG
CATAACGCGCCATTCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCAT
CTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTGAAGCACATGCTGTTGTCA
AGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACGCTGATGAT
GGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAG
TCGCTGATTGGCTGAAGCAACTTAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGA
ACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAGCCTTTTGGTTATGAGCCCAAGCCCCGTCTTCCCTGCCCAAGACCAAGACCC
CGACTACGCCTTCGCCATGGACGCCACCCCGACCGCGACCGCCCGCATCAACAAGTTCAACGGAACCAACTTCCACACGTGGAAGTTCAAGATGCAGATG
GTGCTCGAGGAGCGCGAACTGTGGGAAGTGACGAGTGGGGAAGTGAAGCTGGAGCACTGCACGACCACGGCGGATCAAGCGACGTTCAAGAGGAAGTCGC
GTAAGGCGCTGGCGATCATCTGTCTCGCGATGGAGGACTCG