Description :
From Genome Similarity Track
Location :
Scaffold_1160:851- 7754
Transcript NameFunction/comments
g15488.t1POM61253.1 hypothetical protein PHPALM_29758, partial [Phytophthora palmivora var. palmivora
g15489.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci
g15490.t1POM58107.1 Hypothetical protein PHPALM_37294 [Phytophthora palmivora var. palmivora
g15491.t1hypothetical protein
g15492.t1hypothetical protein

Sequence
6903 bases(100 bases per row)
GCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCAAAGGTGGAGCA
CAAGACTCCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTCAAGCACATGCGTGTGTTTGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGG
CGCAAGTGGGACCCCAAGGCTCGCGCCGGCTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCATATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTG
TCAGTCGCGATGTCAACTTCGATGAGTCGGCCTTTGGACTTTCGACGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGACGCGCTGGA
CCTGGACGACAACGATGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAACCGACCGAGTGGCGACGACGACACTGCCAGAAGATCGCGC
CCCGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCCTCGCGCCGAGCTGAACCCGACGAAGAAAAGTCTGGGGACCAAGATG
AAGACGACGACTCGACGCCCCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCGACGACGTTCCAAGAGGCTGT
GAACGGTCCGGATCAAGTGTACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGC
CAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGC
AGAAGTAGGGCATAGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGATGCTGCGCATGATCATCGCGATCGCCAAGTACGTCGGCTGGCCCCT
CGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTAACTTCGAC
TGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCGGCTTCCAAGTGT
CGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGATGGTCACTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCCGA
GCTGATCGCACGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCG
GACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGA
GCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGCGAACGCTCCGTTTCGAGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCATGCGCCCGGA
CATCGCGTACGCCGTTAGCTATGTATCGCGCTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCACC
AAGACGCATGGCATCTGCTTCAAGCCGGGCGAAAAGATCGACTTCCGTGGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTT
CAGGCTACACGTTCATGCTGATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCTACGAGCGAAGCGGAGTACATCGCGCT
CAGTCTGGCTATCCAAGAAGGCAAGTGGATCCACCGCCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAGACGGGACCCGAGCTCATGATCCGTGAAGAC
AACCAGTCGTGCATCAAGATGACCAAGAACCCGGTAAACCACGGCCGCGCCAAGCACATCGATATCAAGTACCACCACATCCGCGACGAAGTGAAACGCG
GTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCGCTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCT
CGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCCGGTCCAATCC
GAACCCACGCCGATTACGCCACCAAGGATTACGCCACTGTCGATTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTC
TCTCATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTATGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAAT
CAATCACTTTCGAATCTTCGTTCTACCCCTCAAGTGGTTTCCGGTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCAC
GGTGTCCAAGATCCATACCTTCCATCAATTTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCT
GCCATTCCCTGCTTCGAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGTATGGAGCAGCTTTG
TATCCGTTGAAGGACGAAGACTTCACGCCTAGTGGCAGCCTCTCGGCGGCCAAACGAAGCTTCGTAGCGCTCCAACAGAAGGTTGCAGAAGCACCGATCC
TCCGGCACTTTGACCGAGACAAGGAGGCGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAGTACCATGATGACAAGTTACA
CCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCATCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTGTTGAAAGTGTGC
TACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGGTCGAGCGACCCACT
TTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGT
GGAGTTGGAAGACTCGTTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCC
TATACCGGATTTGTGATGTCGTTCGATGGTTCGTCCAAGACCGAAAAGAACGGTGGATACGGCAGTTGCTCGTGGATTTTGTGGAAATTACCAGAATGGA
CTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGG
AGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTACAACTGAAT
CGTCACCGAGAGCTCACGACCAAGCTGCGGTCAGTGAAGTATCTGCACGTGGTCCGAGAGTTCAACGCTGCAGCAGATTCGTTGGCAGGCGAGGCTCTCA
GCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTACAGAC
CACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCG
ACTACCTAACTGCCACAACCAGACACCAAGCAAAAGCGATGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGGGCCGAATGGTGCAGCTGA
GCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGAGCGAGCTGAGAACCGAGCAATCGAGCAACGAGGCGGATCCTGGCGCTCCGAACGCAGAAGAC
GTTGACCCTGTGGTTATACAGAAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCA
AGGAAGCAGACCTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATTTTCTTGGAACGAA
CCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGACTCGTTG
GAAGGTGGCCACCAAGGTATCGGCCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCT
GCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGTTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGATGGATTT
CGTCATACCGTTACCAAAGTCTCGTCGGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCAGACACT
ACCGCTCTGAGGGTCGCACAAGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTAATCCGACATGACCGAGACCCTCGCTTCATGAGCG
AGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTGAAGAC
GGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTCAAGAT
GGCACCCGAAAGGACACTCCGTTTTACCTAGTTCATGGATGGGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGGAGGCC
AGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGGAGGGC
GAGAGAACACAATGAGTCGCTGGAACGGTGCGAGAGAGCTGCAGTACCGAATGTCGATGAAACCGAGACTTCTGACGAGTCACAGGTGGAGACGGGGGAA
ACATCTGACCCCACTGTCGAAGGACCGAGGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTGACCAAGAAAC
TGGCCCACCGATGGCATGGGCCATTCAGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAATTGCCAGACCGAAGTGGGTATAGGTTCTACCC
GGTGGTACACGTGTCCCGACTCAAGGCCGTCAACGAATTCGGAGACCGACCGAAGAGTCGGTTAGCACCTGAAGTGACCGAGGATACGAGACTGGACTTC
GACGAGGAGTTGTTGCCTGAAGATAGCTGGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGCCATCCTCGATGACCGATCCCCGCTGTCGACGA
GCACTAGCCGTGCTGTCCGAGAGTTCAAAGTGAAGTGGATTGGGTATGATGAGCCCACGTGGGAACCTGCCTCAAATTTATCATGTGGCGGACTACTTTA
TGATTATCTGCGAACTCGGCGCAGCGAACGACGATTGCAGATGATTCAAGTCGCTGACGAGAACTAATCTGGAGAGCTAACGAGAGTTGAACTGTCTACG
GGGGTGATACAGCCCGTAGCAACAGATGAAATTTGCTACTGTATCAAAATTGCGAGTGACCGACTATTGATTGCTACCAAGCCTCTGACGGGGCCTGGTT
GCGACGTCGGTTGATGAATGAACTGCCTGCGGGGATGGTGCAGCCCGCAGTGACAGACGAAAACTGCTACTGCATCGAATTTGCATATTTACATGTGACG
TGACAGATTTTCGAATGGAATTGGATTAAATGGAATTACTTGGAGCTCAAGAACTGCCGCTACGGATGACTACGGGCTTCGGACGGCACACTAGCAGCTT
GAGGAACGAACGGAGAAAATTAGTGAGACCAGACCGAAGCCTAGACCTCAGTGGTCGACGCGATGTTAGCCAAAACATCCAGGTCTGACCCTTGGGGAGC
GGCCGACGTGTTGGTCGGTGCTGGAATCGTGGAGTGGCCAGGCGAAGATTCGGAGACGTCTTCATCGGCTGGCTCCTGGCTCGGTTGGTCGGGAGCACCA
CCGACAGAAGCCTGGGCAGCCCATGGGGCTGTCACCATAGCCGACGACAAGGATGGATCCACCATCAACCCAGACACCACCTCCGCTTGCGTCATTCCCC
GAAGCACGAACAAAGGCACTTGGGGGTTGCACGGAGCAAACGTGGTGTTGAAAGGGTGGCTAGCCGGCGCGTCGACCCAACAATTGCGCCATGGTTGCCT
GTCATCCAACGTAGCCAATTCGCCGAGCCAATCCTCTGACGCCGGAGCCCACTCAATCACCTCGAACGAGTATTGGAGATAAGTGGGCTCCAACAGAAAC
TCGGTAATCGACTCGCGAGGCTTGCCAGTGCGTTCAATGCACCACTCCCAACAGCGGTACAGCATCTGTTGGCGGATGCGGTCGGCACGGAGGTTGCGAG
CTT