Description :
From Genome Similarity Track
Location :
Scaffold_897:851- 1887
Transcript NameFunction/comments
Phymu_g12291hypothetical protein PHYSODRAFT_341331

Sequence
1036 bases(100 bases per row)
CCTTCATCACCTCCCACGCAGGAATGTCGTAGGCGGCCTTGGGCAGCTTTTTCAGTCGAGGCAAGTTGCTCGACACGATGAGCACATCGTATACGTTCTC
TGTGAATCTCTTGGCGGTGAAATAGGCCGCTAAAATCGCTACCGACACGGGCAAATTGAGGCCATCGGTATGGGAAATCTCCATGATGATAGCAGCAGTA
GACACCGCGTGTGTGACACCCGAGGAGAAGGCACCCGCACCAATGATAGCAAACTCAAATGGCTCGTAATGAGTGTGCCAAAGACCAAAACCATGCACAG
CCTCGCCAACGAGACGCCCGAAAATGCCTCCGATAACGAACGTGGGTGTGAACAGACCAGCCGGAACGGGAAGCACAATACTGATGAGCGTCAACACGTA
CTTGAGCGGCAAGAACGTCACCAGCGACCTCGAGAGCAGTAGGCTGTCCTCTTCACTCTCGTTTGGCGCGCCATCCGTAGCAAATATTTGCTTGTCCTTG
GAGAAAAGCGCGTCCAGAATGCGTCGAGGGGACCCCTGCCGCAAAAACCAAGCGTTGTCGCCATAGAATTCGAGCCAACACGAAAGAAATGTCACCACTA
GCACAAGCCCCAGTCGCTTGCCAAGCGCGTCCCACCAAGTCCGGAGAGGTGAATTTGATGACGATGGCTCGAAGAAACGGTCGCGCGCACGCACAAGAAT
CGACAAAGAGTAGTTGAAGAGAGCACCACCGAGACCGCAGATAACCCCCATGATTGAAAAGATACAGAGATCAACGAAAGTTGCCCCTCCACTTCCATTC
ACAGCGTCCGTGTCGGCGGAAATCCCCATACTGCGGTTACCAAACAGTCCGTAGCGAGTGTTGGCCGCGCCAAAGTCCACTAATAACGCACCAACGATTG
CTGCGAAGAATGAGCGAGGCAGCGTCCGAACGAGGTAAAAGTGCGAAGTCACCTCCACTCCAAAGAGTACACCCCCGAATGGAGAGCCAAAGGTTGCAGc
tacaccagcagcacacgCACAAGCCAGCATTTCCAG