Description :
From Genome Similarity Track
Location :
Scaffold_2:85087- 112954
Transcript NameFunction/comments
Phyta_totarag131hypothetical protein PHYSODRAFT_506933
Phyta_totarag132hypothetical protein PHYSODRAFT_561505
Phyta_totarag133hypothetical protein PHYSODRAFT_510279
Phyta_totarag134hypothetical protein PHYSODRAFT_510256
Phyta_totarag135hypothetical protein PHYSODRAFT_509429
Phyta_totarag136hypothetical protein PHYSODRAFT_505033
Phyta_totarag137hypothetical protein PHYSODRAFT_505018
Phyta_totarag138hypothetical protein PHYSODRAFT_351613
Phyta_totarag139hypothetical protein

Sequence
27867 bases(100 bases per row)
CTCAGCTATATATTTAGCTGTTGTAGCTGAAGATGCCGTGCGAGTGAGGAGGTGGGAGGGCGAGGTCAGTCGGTAAGCAGCAGGAAAGTGCAAGCTAGCG
AAATCTCAGTTTGGTTTGTTTTTCGTGCTGAGTCAGGCTGTcttgtgttgttgttgtccgATATGTCTATCTGTATTCTTCTCTGCCTTGAGGTGACATA
GTAGCAGGTTTTCGTCATCCTAGATCATTTGTGCCTGCTTGATTCCTCTGCGGCGCAACGCGTGGTCTCTATTACTACTATAGTATAATACGGCGTTTTT
GGCTCATCTTGATCATCTGCTCGACTCTCTTGTCATGAGTGATTAAGCCCTTCCCCGTGCGCGACCCTCCTTCTACCGTACACTATCATGAGCTATGTCT
AGTCATTGTGCAGTGTCATGAAGAGCCCCCAAAGCGAGCCTCATCGAgatgagcttcttgtcgtAAAGCTCACGCGTTCGAGTTTTCAGtatgtgcacca
caccataTAACATTCTGCGGCGGCCAATAATGGACAActtctgcagctggtgcCGGTCGGCGCGCTGGCAGTACCGATGCTCCACATGCGACCCCcgcaa
ggagaaggtgctgtgctccacctgctccatGCTCTGGCACTCGCGCGGCTTTGCTCGCAGCCACCAGCTCACGAGCAGCTACGGAGAAACGCGCTCGTAT
CTCGCCTGGGGGTCGTCACAGCAGgacagcgtcagcaacggcaacggcagcgcTCAGACGGAGGCAAAACCTGCTGCAAACGGATCAAGTGGCGTCGCTG
ATGGCGTTCAAGTTCAGGAAGATGCGATTATTTGTGCAGCTCCtgagaaggaggaaaagCCGAATGGGGAGCAGGATGCAAAACCAGAAGCTACAACGAA
GGAGGATACAGACTGTCCTGAAAAGAGTAAGCACAAGGATGAAgagaagcaggacgagcagatgcaggaagAATTTGAGTTTGAAGTGGTGGGCGAGTCA
GTCGacagtggagaagatggaggcgctgcgAGTGTTGAAAACaaagagctggaagagaagGCGACTGATGCctctgctgaagaaacacCGGCAAGTACAA
ATTCTGTATCAAGATCGGATTCGACAATGGAGAGCTCTGATCGAAGAGCGGAAGAGCAGTTGGAGTCCAATGGAGACCAAGAACACAAGGATGCAACCTC
TGTTCCGGCCGCTTCAACTCCTACCGAAGCtcctactgctgctgtctccgtTCCTGTTCAAGCTTCAGCGACCCCAACACCTGGTCCAGCTTTATCAACC
TCAGCTTCTGATTCTCAGACTCGTACAcgtgctcgcgctgctgttcctgctaCTCCCGAAGCACAGCCGCGCGCAGAACGGACTCCGAGTTCCTCAAGGT
CGACGCCCCAACCAAAAACCGTAGATCTTGATaagctgctgcgctggtTCCCCACAACAGACCATGTGCTGATAGAGATGCTGGCAACACGCGTCGAAGA
AGCCCTTGTCATCGAGGATGCACTCATATGCGCAAGGATCGGGAAATGTGAAGAACCAGCGTGCCGTTCTGTGCTCCTACATTACGAACATTGTAAACGC
GACGAAATGTGTGGCGACCCGAAGTGTACAGAGATATCAATCGTGTACAGGCATCGGCGTGCTTGCTTGAAGAAGGACACTGCGCCTACGATTGATGGCA
AAACGTTTGTGTGTCCGTTTTGCATTCGTATTCGGCAAAGACGGAGTCTTGGTGTCGTTGCAGCGCTAGATCATCTTATTAGTGACCAACGTCGCGCGCT
TCAAGGTGCGCACAGTGAGGCATATCGTAACTTCTGTTTGCAGAGCATCAACACGTGGAACCAACGCAAGCAGGTCCTCCGAGACGAAACAGAGCGACTC
AATCAATTAGCCAGCGAAAGCAGCGCTCCGATCTTCAATTTCCCAAGGTACCAGTGGCACTTCAGTGATGCAGTGTTCATCAAACGAGAACCAGCACCTT
TAGAGAGCGAGAACAATACGACGGGGCTATCTGCACCTGAATCATCAGGGAATGATACGAAtgagtcagcagcaacagagcaACCTTCTTCGAcccgtga
agaagatgaagacaacTTTACTCCAGGTAAGCATTCTTTTGGATGCGAGCATTCCCTTGGTGATCGTTCCATGGTATTTTTTCAATGGTCTAACATGTTA
TGTCTGTCTTTCAGATGACGAGGCAAATACCCAGCAATCGCAGGACACCCAAGAAGACAGCATACCAGGAAACGCAAATTTCAACGCGGACTTTATCAAC
GAGCTACTACGGGCCAAAACTGAAGACAGTGATGGCAGAGAGGTGTCGCAACGGGAATTTGACGGAGTCATGGAACTGGGTTATGCCATTGTGGATGCGT
CATTTTGTGCCCCTTCCAAAGCACAGCGGTGTCTGCTCAACTGCAAGTCTATCCTTGTGCACCTGCAACACCACCTGGATCTGCAGGTGTGCACTAAGGC
AATGTGCGCAGCAGTGGAGCACCATTTCGCGCATTTGTCACAATGTAAAGCCCGCGACGAAAGTGAGTCTTGCGAGTATTGCTTACGAGTCGAAGAGCGC
CAACTGATCCGATCCGTCGATTTTATGGAGGCAGAGCAaccagaagctgaagcgaaAGTGCAGAAGATCATTAACGATATTACTGCCTCTTTCACGAACC
ACCGGCCTGATGAACGGGAGCAGGAGGTGATACAACTGGAGGATGAATTAGACCAAGCGGAGGCCAACAAGCAAGAGTTGCTGGAAAAACTGAGCTCTGC
GCGCATTAACCTCCGTAAGGTTCGCAGAAGCATGGAGCGCCAAGGCATGTCTACCTCAGCTAGCCGTCGACTCCCAGTGCATTTCATCAAAGTTCGGCGT
GCCGAAGGATCAGGTAGCAGCTCCAAAAAGCGGCGTCTCGCTGGCTCGTTTGACTAGGAAACCAATAGTAGTAGTATTATAGAGAAAGACCCAATACTCA
ATGCCGAAGTGCTGGCCATGCACAGCAAAATGAAAGCTTGCAACTATCAGTAGCTATGAAAACTGTTCAGGGAACTTCAAAGTCAGATTAACGCCGTCCC
CATCCAAAGCATGATATGCATCGACATGACCTGAAacatcgtcttctgctgcttcaaggCGAttacttctgctgcagctatCAGAAAGGTAGATtagaag
ctgttgcagcaccagctggATTGGTTTACATTGCCTCCGTTGGCAGCACTCGTGGGGCGGAACGTGTCattgcgcttcttcgcttcaGACTTCCGCTCGA
AAATGTCCTGGTGCTCCAAAATACCCGTCACTAGCGCCTTGGCAGCATCGTCAATGTGGATATTTTCCTTGGCCGACGTGTCGAACCAGCCCGTAAAGTT
GTTGGTCTTACAGAACTCGTCCAGGAATTCCCGGTCCACATCTTCTTTCAGGTcacactgcagcaaccaTCAAACACTCAGTCTCTTCAACACAGCACAA
ACTCAGCAGTAAAATATAACCACTGCAAACTCACCTTGTTGCCGCACAAAATGACGGGCAGCTGCTTGCCATTGGGAAGTTCCACTTTGGAgtcgatctc
cttcttccacTGCATCAGCCAGCCGCCAAACAACAAATGCAAGAACGAAAAAGCTCAGTATCAACAGCAGCTCAACCGTGTAACTTTCCGCCTTTCCCTC
TGTACCTTGAGGGCGCTGTCAAACGTCTCCGGACGAGACATGTCGTACACCAGCAACGCTCCCAGCGCGTCCTTGTAGTACACTCGGTTTAGCGCCCGGA
AGTGCTCCTGGCCAGCGATATCccagagctgcagacgcacaGTCGTGCCGTTCACTGTCACCGCCTTCAACGCAAAGTCCACGCCGATCGTCGTGCGGTG
GTGCTCCGAGAAGGCGTCGTGCACGTATCTGCCGAGACGCATCATATCATCAGCCTTCAGCCTCTCTCTCCCTCGGATTATCGACCGAAGCTACCGACCA
ACGCACCTCTTGATGATGCTGGTCTTGCCCGTGGCCGCATcgcccagcaccaacaccttGATGACCGCGTCCTGCGCGGCGTTCACCCGACGCTCACTCA
TATTAGTACTGTATCAACCCGCGGCACACGACGAGATCTCGAACTGATTCTGTCCGAGAGAAACAAACATCACCTTGAATGAGAAATCGGCTATATTTTA
CGTACGCCACATATACTACGTACACCACTTCATATCCAGATTAAGTACGAGTTTGATTTTACCTTGCAGGAAGGCACATCCCAAGCCGAGCCAAAATTGG
CCGCccctcgctctcgctctgtCCTGTGGCTTCCCgccatgagcgacgacttcgagcgcGCCAATATCCGCACGCGTCCTCGCCGCCGCAGCCGAAGCAG
CGGCGCTATCCTCAACACACCCGCGCCCGCCACCTCCAACACCACAGTCTCTACAGTCTCTGACCCCAACGTCAGCAATGGAgagcgcacgctgctgccC
AGCGACGTCATGGAGCTCAGACGCAGCGCGTCAGCGGACCATGTGGTGGCATCTGGGAGGCGTCTGAGTCGCTCAGGCTTCAACCCGTTCGGCCACAGCG
GCGGCCTGAGCTCCTCATTCCGACTGAACAGTGCCGGCTCGAGCTTCCGAGCGGGAGCGGGCGTCCCAGTGTCTTCGTCGGCATTGCGGAGCCATGCCAG
CTTCCTCATGATGGACATTGATGCTGCCAGGCAGTCGGTggatgctcaagctcaagctgcaggtgccAGAGCCATGAGCttcgatgaggacgacgcagtT
TCTGACGGTGGGAGACTTACGAGGAACATGCTGGGAGATTCCACTAGTGGGAGAAGGAGCAGTGGAGCTGAGAGATACAGAAGAGCGTGTACGTTGCAGc
gtagagagagagaaggtGTGGAGGAGTTTGGTGGGACTGATTGACTGATTTTATTGTTTTTTATTGTTTGGTGTGTTGATTGAAACTATTATAGCGTCGT
TGGATTCGAGTCCGCCGTTGCCTCCGGATAGTACGATATCGGCGGAGGAAGTGATTCGAGAGAGTATGGCGAGTGCACTGAGCTCGTCGTTGTATACAGA
CAAGGACGACTTTTTATTGCCGCATCAACGACGATCTACTGCGATGGGTGGGAATTTGACAGTCAATGAGAGAGACTCGCTGGCCATGTCGAGACATTCG
CGGGacagcttggccttctcgttTTCGAGTCGCAGTACGTTCCGAAGAAGTACGATTTCGGAGCAGATGCTGTATGAGACGGACCTGTTCGAACCGGAAC
GTGAACTCAGTGTGCGGGAACTCTCCGAGGTGCTGAGCGGGTCGGACGAAGATGCCAATAGTTATGAAGTTACCAGTAtaaaggaggaggaagaggatgt
CAAGCTCGAAAATGCCAAATCTCGGTGGGCACAACACGTCAAACTCAAGGCACGGAGCTTCCTCTACTCTACAGTGGCGGGCAACAAAAATGGATCGTCT
GCTGCTagtgacagcagcaatggtggCGCCGTGACTTCAGCGACACCAACATCGGCAGAAATTTGGGCGAACAAACAGAAGCAAATTCTTGCGCAAATGA
GTAGTGGCAGTGGCTTTGGTGCAATGTCGGGCGCCTCGTCAGCtgcgtcatcgtcatccacgcACCATCACTCACTGTTGCCCCCACTGCCATCATTTGG
ACCAGCGACTAATGGTGGTGCCAAGTTCCAGAAGTGGAATCGATGGATGCACAATCAGTATCAGCACAATTTCGGCAAAGTCATGCAGCGCGCCTTCAAA
GACGAGGTtttgcagcggcagcaacagcaatttGCGTTCCCAGCGCATCAACCAACCCCAGACCCGACGACACTGATTTCCATTGAGGAAGTTATTAGCA
ACCCGCGTATGATGCGCTACTATGCTGCATGGCTTCCCGATCCTGCAGACCAGAGTAAATTGTTCTTCCTCTGTTCCTTTGAGGAGTACCGTCAATTTTG
GTGCACTTTGCGTGCTAACTACCAGAAGAAACCTTTTGCGAAAGATGACGTGCTCATGTTACGCACCTACGGCGTCAAAATTGCAATGAAATATTTGGCG
AAAAACGCGCAGTTCCCAATTAATGGGCTCGCTGATGCTAACGGAGGGGAGGGTAGGAGTGACGAGCCTCCACTCGTGGACTCCAACAAGCTACGCTCTA
TTAAGCGCGATCTGGCGGCTGGGGGAGAAGATGCACTACGCACTTTCGACGATGTCGCCGTGAAGGTGAAACGCGTGCTTATGTTTAAGTTTCCTGAGTT
CCGCAAAACGGAGCTCTACACTGAGATGCAGAAGACTGTGGAGCGTGAAGTCATCTGCCTCGAGGATATACTGATGAACCACCGGTTTGCCAACTTCTTT
TGGATTTTTCTTTTCCCGCACAACTACCATCGCGAGATTGCGTTGTGGTTGGACGTCGAATACGAGTTCAAGCCAGCGTTTCGCATTTATATGTCGTTGC
TCAAGTCGAGTGGCAGCTCCagaagtgctgctgcgtctggcaACAACCAGCGTCGTGAGCGCATAGAGCAGTCTGCTTACCGCTGCAGGAGATTGCTTAA
GTACATCTCACAGAAATACTATGCTGGGGACGTTGAGATGCAGACTCTGTCGCGCACGCTAGTGACGTCCTGTGCCCGACTTCAAGCCGAGCAAGATGCG
ATTTTGACGAAGTTTAGTCTCATCCACCTGGAGCTGTATCATCGCTTCCTAACGAGCCGTGCGTACGCCGAATTTTCGCTGTACCCGAAGCTTTCACCtg
aggacgagatggacTCCATCGACGACTCCATGCGACTCTCGGCGCTGCTTCTAAGCTATGGCTTGCGTGCACATCATTGGGTTAATGGTAGCTCGAGTTC
CTCGTCATCTAACGGTtcaacgtcgtcttcatcgtccagTGCACGCGAAGCTGAAACTACAACGCCAAAGAGGAAGACTCTTGACTCACTGCGGACTGCA
CGGAGCTTTGAAGCTATCTCAGGCGTGCTCACGTTTGAAGCTGTATCCGTGCCTATAACAGCTGAAGACGCGGAGAATGGCACTGACGAGACTGGTAATG
GTGTGTTCGAAGACCCGATTGAGCTGCAAGTAGTGCAGCATCCATTGCCACATGACCCAACACCACATATCGTGGACAAATCCGTCGAGAACTTCCTTGT
CCCTTGGAGTGCGGACCCTAGGCACGTGGTGCTGACAGCACTGTCTTGCCCAGCACCTCTTGCGTTTAACTTTCGTATGGGTGACAGCAGTGCTGGCGCC
TCAGCTGCTGAATTGTTTGCGGCGTGTGTTGTTTTATATAAGCCAGCACCCCCATTATCGCAACGCGCGCTCGAGACATCACAGATAGATTCTGCAAGTG
GTTGTCGATGGGTGCCTTATGGAGTGTGCGTGCTGTCTAAATTTCCAATGGTGGATCTTCTCCGAGAGCGTCTCGCGGAAGCATACGAGTTCattcttga
gcttgagactatcgctgctgctgctgctgttgctgctgcagctgtcgccaacagcgatggcgacggtAAAGGGGTTCTTCATAATGGTGGACATGGCTTT
CAGCTAGACAAGAAGGTTCTTGCCAAGCTAACACGTGCCGTCGCAAAGGAACATATCTCGCAGTATCACCAGCCATCACCGTTGCCGGAGTCACCGCTGC
TCGAAGCCTCTGGCTTAACCCCAAAAGCCACAGCCACTTCGCtgcttgcagctcttccgcgtCTGGACCACTCCGTCCGTCTTCTGTTCGACACATTAGA
CGTATCCACCGTGCTTCTTGTGTTCACCGCAGCTTTGCTGGAGAATCGCATCctgctggtgtcgtcatATCTGTCAGTGCTCATGAAGGTTGGCGAGTCC
CTGCGAGCACTCATGCACCCGTTGTCCTGGCCTCACGTGTACCTACCCGTACTTCCACGCCGAATGCTACAGTATCTTGAGTGTCCGACGCCGTTCATAT
TTGGTGCTGAGAAGCAAGCGCTTGACGATGCCCAACGCCAAGTTATTGAggaaggtggtgacgacTTTTTTGCCGGAGCTGGCGAGGAGTTGCTGGTTGT
GGACTTAGACAAGGGGGCTGTTTTACGCGGAGAAGTACCATGCGCGCTTCCTGATAATGTGCGGTTTGCTCTGCGCGACGCTCTCTACGAGTGTCTCAAG
CCGAACGTGAGCCGTAGTGACCATGTGTTCGCACACCACTTCCCAAGCAAGCCGCTAGTGTTTCCGGAGGTCGCTGTCCGCGGACTTTTCTTGCGGGCTG
TCAACAAACTCATTGGTGACTTTGGCTACCACCGCTACGTTTGGACGGACGAGTTTGCGCGTAAGCGCACAGTCTTCTTTGACGAGGCCAGTTACCTTGC
AGCTTCCACGCCTGAGATGCGCGAGTTCCGAACACTGTTTATCGCCACGCAGGCCTTCTCGGAATTTATGGTCACACATCACGGCTTCGAGGAACAACCA
GGTCAGTCTAATGGCACCACGGGGCCTCCGAGGTCGTCTACTTCTATGTCTTCtacttcatcgtcgtcctctgTATCATCGCTGCCGCGAAAATAAGCCC
GGCATGCTCCAAACGTATGTGTGAAAATGGACGTAGGATGAAGGTGGGTAAACTTATATGTACGTGACGTTCGCGTTCCTGAGCTAAACCAACTTGATAT
TTACTGTTGATGTGAGTGAAGTTGCAGCTTGTCTGCGTAGTTTGTGCCAGTTGATCTAGCAACCACTTCAGCTTTAACTAGGACGAAGCATGGTTGCCAA
CAGCGTCGTGGCTGCCAGCAATCCAAAGACCGTCGCAGGCGCTGTGAAAATCGGCTTCCACGAACTCTTCGCCGTActcgccgcagcagcactgggaaca
ggttgcagttgctggtgtTGACGGTGGCGTGCCATTTCCTTGTCAATGATGGTGTAAAGAATGGCAGCCACGCGACGGCCGCTGTGTTTGAGCATAAGTG
CCTTGTTCCATTCGCGCGCCACGTGACCAGTAATGAGGTCTTCTTGGAAGGTTTGGCCCTGAAGCAGTACTGGGTGCTTGCTAGCCGCCATTTCGGGAGT
aggcagcaacagctcttCACCACGCTCCACGTACGGCACAAGCACATCTTCGGGTGGATGAGTGTTGTTCGCGATCACGTAGTCGATCGCATTCGCACCA
AGATACGTGGAAAGCACCTCGAGTGTTTTCTCCAACGTGTAGCCGTCGGTCTGGCCATTCTGGGTGGTCACGTTGCTCACGTACACTGTAGCGCCCGCGC
TGCGTGCGATGGCATCGCGAACACCTGGAACCAACAGCGTGGCAATAATCGATGTGTAGAAGCCACCGGGGCTCAAGATGATGATGTCAGCCTCCTCGAT
GGCACGCACCGCAGGCTGGAAGGCTTCCACGTTTGGGTTCTCGAGGTAGACACGTTTGATCGGCGctttcttgatcttctcctttGGGATTTCAGGCTTT
GGAGGCGTAGACGGTGGTGTTCCACTTGTGCTGTTTGTTGAGGAATCGGAACCTGACGGAGgctcgtcctcttcgtccggCACAAAGGGGCTGCGCACAT
TGACTTCCGAAACGACTGCAGATCCGTCAGTAAGCTCGGCGCACAGCTCGGTGCTTTCGAGTGTGGCCGGTAGCACGGAGCCGTGGATGTTGAGAATATC
AGCGATTGACGAGATAGCGCGGTCGAAACCTCCCTGCAGGTCGGTcagcgctgccagcagcaggttaCCCAAGCTGCAACCCTCCATGAAGTTATCTCGG
AAGCGGTAGTTCATCAGCTTGCTCAAGAGTTCATCTACGCGTGCACATACGAACGAATCTACTGTGAGTACACACACGGTGGGGTTCATGGAGACAACGA
ATTACGAACCGGAGTCGGACAGCGCCACAAGGCAGTTGCGAATGTCTCCGGGTGGCAGGATGCCAAGATACTTGCGAAGAGCTCCAGAATGGCGACCCGA
GTCGAAAACTAGAAGAGGTCACGTTGCCGCAACCAGTTAGTTAGCTGCTACTTCTGTAAAGGCAAACAACAGAAATCGACTTGAGTTGTTGAATGAGAGC
ACGAACCTGTGACGACGGCTGTCAGATCAGCCGGGTAGTGGCGCAGCTCCTTAAGTAGCACTGCCAAGCCCGTGCCACCACCAATAGCCACGATCTTggg
ctgcagcatctgctggtCTGCCAGTTGTACAATCggcacaagctgctcgatcGACTcaatctacatgtagcatcaCCACACATCACACACAGCAACTTAG
TCTTCCGTGTAAGCGTCGACGGAGCAAAGCTGGGCTTGATGATTCCTCACTTGGAAGTCTggctgctccatctcgtccgtTGGCATCACGCTCGTGTACT
TGCCGAAGAGCTACAGacaaacaacaacaagcaaAGTCACTAAAACATCCCAAACAACTAAGCAAGCAATTGTCTTCAAGCACGCACCATGCGAACAGTG
AGCATCCCGACCGTATTCGCAGCCTTGATCTCGTAGAAGGCCTTGCGTCCCACGAACATGACGGCAGACGACGGCACGTCCAGTTGTCTCgtgagctgct
tcatggcGCTCGTCACTTGAGCTAAGCTCGGATTGGGGGTCACATGGACCACCTGATGGAACAGGTCGTCGACTCCCAAAGCTTTGAGGCGTTCACGCTG
CACCTCTGGCTTGccgatcagcagcagcgccaagtggCACGCACCtccgtcctgcagctccagcagcgtcttgcgtACACCCGGGAAGGGCGTGATACTG
CGAGCTTCAGGCACATTGCTCTCGTAATAAGCAGCGATGACTCGTTGCGCTTGAGTCGGCGAGAGTTTGGCTTGTGGACCACCTACGAggctgtcgacga
agcggGGGAAGCGTTTACGGAGTCCGTAGGCGTTGCGGAAGGTCTGCAGAGCTTCGAACGCCGCTGCGTTGGTCGGGAACGCGCCTTCCGTCAGCAATTG
AGCGACGCCGCGGTCGATTGCCAAGTGTGACAAGAGGCCCGAGTGGTCgtacagcacgtcgtccaggatcATGGCCACGGCTCGTacgcgacgacgacgc
ggacgggaggaggaggaagagggtGGAGACGTCGGCACACGCATCCCGCTGGGAAGACGATGCAGCGGGTGCTTGGTAGAAGGAAAAGTGGCGTCGGTCA
TGCGGGTAGAAGGGAGGAAGGATGGTCGACGCTTCGACGACTGCGGTACGTACGATGAGGAGGGTCACGTtctccaagcagcaaaagaaggTCCCACCGT
CGTGGACGGACGGGACGGGCGCTATTATCGACGGGTGGACAGACCGTTGAACTTTAGACGGAGGTGCAATTGATGGGGCATCTATGGGGTATATGATCAA
GCAGGTTAGTTCGAGGATCTAGGGATCTAccgacgctgcagcatgcGCAACGCCATCTCTTCATGGCTGACAACGGCGTGACGGTCgaccttcctcttct
tgtcACTcacgtcttcttcctcctcgtcctcctcgtcactaCTGCTggcctcctcgtcgctgtcgctgtcgttctcgctgccACTACCGTTcatgtcttc
gtcgtcgtcagagCCAACCACAAGACGCGCGCCATCatcctcgctctcgtcgtcaCGGTCACCCTTGACTTTCATGCGCTTCTTGTGGTGCTTGGCACGC
AcacgctccttctccagacGACGGTCCTCAGCATCCTTGGCGGCGAGACGAGCTGCCACCTGCTCCGTGTAATTCTTGGCGTGCTGCTCCACGTCAGCAA
ACTCACCGTCGTTACTGCTACGCGCCACAAGACGGTCCGCTATCTTGGCACTGTtgccctcgtcgtcgaacacgagCTTGGACGCGTTGATGGCCTCGCG
GTCCAcacgcagcttcttctgtttcttcttgctaGGGCCAAGTGCATCCAGATCCAGcggctcgtcgtcgtcttcccaGTTGTGTACTCGCTTGACAACC
ATAAGCGagtcttcctcctcctcctcttcttcttctaacttctccttctcttgcTTCTccaatttcttcttcgcctctTCCTGTTCCTTGGGACCCAAAG
CAGCCAGCTGCCGCGCCAAACgcttgcgctccttctccgccttaATCTtttccttgagctgctggagcttaCGGTTGACGTTCTTCTTTCCGCGAAGCTC
GTCACGCAACGCCTCGTTGCCACCCTTATCGAACTCAGCCTTCATTTTGGACAAGAACGGCATGCGCGGTGCGCCAGGAAGTCCCAGCGACTCAGCGAAC
GCATCTAGAGGCAGAGCAGTGGCATCAAACACCTCGCGATCCGGCTGCAAGTACACAGAGCGCACGTAAGACATGAAAGCCTTCTGCGCCAGCGCTTTAA
TCTCCTTGTCACCGGCCACAACGGACGCCACCTTCTggcggcagctcgtggtcTTGGCTGGGTTTAGCTTCGTCTCGCTGATGGGCACCTTGGCACCTTC
GAGGCGCTTCATCATGCCGTCCACCTCAGACGGCACGAGGCACATCAGAGCCTTACCCTGCTTGTTGTAACGCGCCGTACGACCGACACGGTGGATGTAG
TTAGCAGCATCTTCGGGGcagtcgagctgcagcacccagTCGACCTGAGGGAAATCCAGACCTCGTGCCGCAATATCCGTGGCAAACAGAACCGCGGACG
GCTTGTTCAAGAACTCGTAGTACACCTCCACACGCTTGCCCTGTTTGTACTTGCCGTGCAGCGCACAAAGCGGGATACCAGGCTGCAGTTTACAGAAGAC
GCTGTTCACGTAGCGCACTTGACGGCACGTGGACAAAAACAcaatcgtcttctgcttcaggtGCGACTTGATaaacgacagcaacacaTCCAATTTACGC
TCCAGCGGTGTCACAACGTAGCTCTGCGAAAGCCCCTTTGGCGTCGCGTTCGCCGAGTGCTCGTGCACCGCAACGTACTCGGGCTCGCGCAGACTCAGCG
CTGCCAAATCCTTCACCGACTTAGTCTGTGTCGCCGAGAAGAGCATCGTCTGTCGCTCTCCAGCAGGCGGCAAGTGCTCCAAAATGGCTGTCAACTGTTT
CTGGAAGCCCAGGTCCAGGATCCTGTCcgcttcgtccagcaccagcacctgcaagTTGCTCGCATCGAACGCCGGCGTCTGCTccatgtgctgcagcagt
ctTCCAGGTGTGCACACCAGCAGGTTCATCCggacgagacgcagctgcTCCTCACGGAAGTTCTTGCCGCCAATGACCAGGCCGGCCGAGAACGCGTGCA
CCTTGCCGACGttgcgcagcacctcgaagatctgcagcgccagctctCTCGTGGGCGATATCACCAGCGCTCCGAGACCGTCCTCCACGCTCCAGCGGAG
GCGGAACAGCTTCTCTAGCACCGGCAGCAGGAaggccagcgtcttgccgGAGCCGGTCTTGGCCGCCGCGAGTACGTCGCGCCCCGCCAGCGCGTGCGGC
AGCGCGCCCACTTGGATTTTTGTGGGCGCTGTGAAGCCGCAGGTCCTCAGGCCGCGTCGTGAAGCTTCTGACAGCGGGAACAGGTCGAAACTGGCGGCTT
CACCGAGCTGCGAGCCACGCGCAGGGGTGCGTTCGGCGATGCGGGCCTTCAGACGCtcgatctcgagctgctcgcgctcaTTCTGCTTGACTttggcagc
gacggcagctgcagcggcttcgTCGTTTTGCACCGGAGGATTCGGGCGGCTGTGGGCCTGGCGGAACGCACGCGAAGCCATGGCAAGTGACGGCGGAGAT
GACGCTGGGACTTGTGGAGCTCTTCGAATGGCTGGCGCAAAATTGAACGAGTGTTCTTAACGGTTATTGTTAGAAACAAATGTGTATaatgtatacatgt
atacatgtgACGAGGCGAAAACTTCAATATGAGTCGTTACATGTATCGTCTGAGCTCTtcgtgatggtggaggacgaggtgaagctggtgcGGGTGCCTG
TACGAGAGCTCAAGACAGCCATGCAGGGGGCTAGAGCGGTGCTTGATGAGAACCGCCGCCTGGCTGCAGAGCTTGCCCaggcagaggaggaggcgagGGA
GCTCGAGGCCAAGTTGCTCAAGCGACAGAGTCAGTTGGACTGCTGCACTGGTGTCCGCTCGGAGAATCGTCCGTATCGCCCGGGTGAGTTGTTCAAGTCC
ACGCCGCTTAAGCGTCCACGACCCAAGAGCGAAATGTTTGGCGCTAGCATGCGCAACCTCATCGGAGAGCAGGCCGAGACGCTGAACCAGCTCACAGAGC
GAGAAGAAAATGTACGTACGTCCGTCTTGCTGGACTCACCAGGACGATTCTCGATTGCTGGGGTTTCTTGTATCAATCACAGCCACTGATACGCTTTTAT
TGATGCAGCTCCGTGCGCTCATGGATGCCATGCGCGAAATCTCACAAGCATCCGACAGTCTGGACGTCGTGAGCAACGCGCTTCGTGCCGCTCAGCACAT
GCTCCCCGCAGAGAAGTACACCGTGGGCATCCTCAACGAAAAGAAAGACCGCGTGGAGCTTTACTCCAACCCACCAATGGATTTGGCCGGTAAACGCTAC
CTTACCGAGGACGGCAGCGTCCTGGTTGATTCAGCCACCACGTTCGGCCGCGTTGTACTGGTAATTGCTGCCGCAAAATTGTTCTTTGtctttctgctgc
ttcgccgCCTAATCACGTTTGTGTGTCTCGTGGATTTCAGACTGGAACAGCTCTCGAGGTCGCGGATGTCGGCGGTTCTGAGGTCGTCGACGTATTCGAA
GAGCAGATGGAGCTCCTGGAGTTCGAGCCTGAGGCGTTGCTTTGCGCGCCCATTTTCAACGTGCACGGAGTACTAGTCGGCGTCTTCCAGGTCATCACCC
GCAAAGTACTATCAGAGCTCGGTCTTCCTTCCTCTCCAGCTCCCCCACCAGAGTCTCTGTGGTTTTCATCAACTCCGCGTGCTGCCTTGGCAAGACTTGG
ACGCAACCAGGAAGCGCAACACAAAGGAGCCTTTGACTCCCGCGACAAAGAGAGCTTCGACTACATCTGCGTAACTGCAGGAACGGCGTTGTGGAACTTG
TCGCTTGCGAAAGCACATCAAGCCATGCAGAGCCGCATCGAATGTCTCCTCAAACTCAACCGAAACATCGCAGCCGAGGTCAGTGCATCGGCTGTGCTCC
ACCAAATCATCGCTGTGGCCTACGAGCTCGTAAATGCCGAACACATCGCTCTATACGTGCGCGACGAAGGCACGGACGAGTTTTATCTCTTCATCACCGA
GTGCAAGGACGGGAAGGTCACTGCAGCGTCCACAGGCACCAGAAGCAAATCGAAAACGAAGGACAAAGCGGGCGAAATGCCTTGTCACTCACACGGGCGC
CTGCAGCATGGCGGATATGATGAGACATTCTTGAAGGCGCACAACGGCATCGTAGGTGTCGTTATACGGTCAGGGCAGCTTGTACTTGCGAACTCGGCCC
CAAGCCATCCAGCATTCGACCCGAAGTTCGACGAGTTGTGGACGTCGCTTAAGACGAAGCAGGTGCTCTGCGCGCCAGTCAAAGATGCGGGTGGTCACGT
CTTGGCTGTCGTGTGCGCCACCAACAAGGTCGACGGTGACGAATTTACAGCGGACGACGCACTCTATCTCAATTacgctgcagaagccgcGGGGATCTCG
CTGCACAAATCCAACCTCCTACGCTCCGTACTGATGTCCCAGCGGTTGACCGAAGCACGATTGCAACTTGCCGATTTTGTGAGCAACAACGGTGAGCGTG
TGAACAGCAACTCCAGTCACGGATTCGATGACGAAACCAGTGCAGCTGCCTCAGTCGCTAGATTTGTGCGTGTCGTCATGGTGGAGGGCCGAAAACTGCT
TCATTGCGACCGATTTggcttcttgctggtggatcCGCTGAAGAAGGAACTCTGGATCacccaagaagacggagagaGCGTGCGGATGCCGCTCACAAAT
GGTCTTTCTGGGTTGATCGCTACGACAGGGAAGACGATCAATACTCGGGACGCTTACACAAATCCTCACTTTGATCCCACACTGGACCGCAAGACAGGAT
ACCGCACCACAACTGTGCTCGGCATGCCCGTGTTCGAGGATCATACACCAACCAACCCCAAAATCGTGGCTGTAGTTATGGCCATCAACAAGaaagacga
cgctgatgatgGAACGAACAACTCGAAGGTAGATGCTGACGGCTCTGCTCCTGTAACAAGACATCGTATGCCTTTCACTGCCAGTGACGCCGACTGCATG
GCTCAGTACTGTCGAGAAATTCAATTCGCGCTCGGCCGATTGTCGCTGGACATCTCGTACTACAAGGTCGTGTCAGACTGCGGACTTGGCACACCTGGTG
AGTCTTTGGCCGAATCCACCGACACATCTAAAGCGCAGAATCAGCACCAAATGGACGACGTGAATGAACCGGAgatcatctcgtccatcGTACAAAAGTA
TTGCCAATCTAGCGAGTTGGAcgcgctggaagagctggcaaCTGCAGCCATCGCAGACGACCCggacgaagtcgaagacgcgGATGAAACAAACGGTGGG
GATtatgatgacgatgatgacgacactgaggacgaggaagcgCACGTGACACCATTTGCAGCTATCCCGTTCCCGCAGCGACGGATTTCAACAACTCGTG
AGAATGGACACGTGATCGGTGTTGGTGACGTAACGCGCTGGGACTTTAGCTGCCTCGATCTCTCCAACGCGGATATATTCGCGGCGACATCCGTGCTCTT
CCGCTCGCTTGGCTTGCTGGAACGCTTTCAGATTGCGCAGGAGACATTCTCCACCTTCCTCTCGCATGTGGCATCTCATTATCGCTCTAACTCTTTCCAC
AACCTTCAACATGCCTTCCAGGTCACGCATGCAACATATTGCTTACTGCGTCGCTCCGGTGTAGCACCCTCCTACTTCGCACGAGTAGAAATCTTCGCTA
TACTCTTGGCTGCTTTGTGTCACGACTTGGACCATCCTGGCAACACAAACGACTTCGAGGTGAAGGCGCATAGTCAGCTTGCACTCACGcacaacgacga
cgcagtTCTCGAGCGCCACCATTGCCGCGTCGCATTCATTATCTTGAGTCACCCAGGAGCAAACCTTCTGGCTCGGTTGCCTTCACGTGTTTGCTTTGTG
TATGTGCGTCGACTGCTCATCCACTGCATCTTGGCAACGGACATGGCCAAACATTTTGAAAAGTGCAAGGCACTGGAAAGACTCTCCAAATGCCATCTTC
TTGTCAACAACAATGGCGGTCTAGGGACAAAGCGAAGCCGGAGAAAGCATCGCTTTGTTTTCATGGCAATAATCATCCATGCAGCAGACTTGTCCGGCCA
GGCGCTACCGTACGCACAGGCAGTCCGCTGGGGTAGTCGTATACTCTCCgaattccagcagcaagcaaagAACGAAGCCGAGCTGCGCGTTCCTGTAGAT
TCCTTCATGACCAATCTGCACCACGCGAAGACCCGTGCCACCGTGCAGCTCAACTTTATCAACTACGTTTTGCGTCCCATCTGGTTACCACTGGCCACGC
TGTGTCCTGCCGTACGGGTATACGCAGACTCGCTGGAATCCAACCGGGAGCGCTACAAGGCTGAGCTGGACAAACTTCAACGCGAGGCTGAAGAGGTTGA
GGAGTTGGCAAAGGTTTACGTGCGTGGATCCAGTTCACACAGCCTTGTTGAGCGCGTTCCGAGCACGAGCCTATCTGATCACCAAAACTGACACTGCAAC
CCAAGATGTTAGAACAACACGCGCTGCAGGCAAACGAgaagctacatgtagttacgAGATAAATGAACATGTTGAGACCCAAAGACGATCCCGCTTTCTT
TCCGAGCTGCAGCCATTTGCTAAATCATCCTCGACGTGACAACACTAGGGTGCTCTTGGTGCTCACAATGGCAACAACGTTGCTCTGGTCCATTAGCacg
tcttcaacagcacgAGCGCGAGCGTTCGAAAGCAGGTCAGACAGCAGGTTCTCGACTTCCTCCTCGGGTTCGCCAGCCATCACAATATGCATCAGTGTGC
TGCGCAGAAACTCGGCATCCAATTGAATCTGCTGTAACCCGAACTTTGACAACTCCAACAACCTCGCCCACTCGCTGAAGGCCTTGATGCACATTTTGAG
CATGGTCTGAACGAATGCATCTGCTGTAAGTTCTAGCTGGGATGGGAAGATATGGATTTTGCGTGCGAAGATCCGATCCACATCAAGCTGCATGCccgac
gttgctgctgcaactcctgCGTTACGAGACCGCAGCACACTGGCACGCCGGCGGAAATCTCGACTTGTCGTGCGACTGTTGTTTCCAACAAAAATGCTTT
GCTCGTCGCCGAGTGCCACAGCAACTTCTTTTCCAAAACGGAAAGTGGCCTCTACAACCGCAGCCATCATTTCTTGCACACTTCTCGGTTCCTCATCCAT
GTCAGCCCACGACGTAGCAGCCACCCCGTTATGGACGATGATACACAGCTGGTTGCCGTAGTGCTTtgcgacgtgctgcagtaGCTCTGCGGAAGTTTCG
CGGGTCACTTCAATCATGTGCGTTACGTCCTGCTGGCTCATCCGGTGACTGCGAATCGGTTCACTGTCGGAGTTTTTCGATGGTGACAAGGGCGCTGGCA
TACACTCAATGAGGCCGCGGACACACTCGCCAATACCCCCAGCTGACAGCTCTTGGCACATGCAGGCCAGGAACAGCAAAAACTGGGGAGAAGGCTCCAA
CCACGGAAGTGTTACATTGTCTTGCTCCTCGGCCCGATTTCCAAGCGGTCCATCCGGTTGAGTAAACGCGCGCTTGGGCTCCGCGTATTGGAGCACCGAT
ACGTTGAACCACTTGAGGAAATCGTAAAATTGGCTCTGGAAGATCAAGCATTACGCAGAGTACAAGATACATTAGGACCGACCGTACTATTGTGTGCTGG
CAGACAAATCGGTGTAGATCTTACCTGGACTAAATCAGAGAAGAGTCGGCTCAGTTCGAAGAGAATCGAAAAACCTGTTTGCACCATTGGCtccatttgc
tgcagcaccttctgcaTCATGTCGGTAAACGCCCTCGCTGACTCCTGCGCTAAAGGTTGAACGCTCTGTCCATCATCGCGCGAGCTTCGACCCAAACCAC
ACACGTCTTCGTGAGAAGTAACAAAGAGCTCCCCAGTATCCTCGCGTAGTTTCCGAAAGACGCCTTCAATCTGGAAGCACACACAGCTCTCCACAATTTC
AGTGGCATTTGCAGCCAGTCCACACATTGGAATGCTTCTGTCCACAACATTCACTTGCGAAACAAAGTGCTTCATCACTCGCATGAAGACAAAGTACTCG
CTTTCGACGATGTCTGACGAGAGGTCATCATCCTGCAGCACGTTAAGGACTTCATCCGTTGACCCCTGCATGAAACGAGCAAGTGGTGATCATTAATACT
GGGCGTACCAAAAGTCACAGTACAGATACAGCAGTGATGAGCTTACAAAGTCCGTGTGGGGGCGACGGAACTGTGCGACGCACTCGCCCAGATACAGCGC
AAACAGCTCTTTCACGAAGCTGAGGAACAAATCGTCTCGAATTGCATCGGAGGACTTGCGTGATGTCGACGATTTCTCGCGCGCGACGACCTCGGGCATA
AAGTGGGTCTTGTACACTGAAAAGACTCGGCCCATCTTCGATAAGACCTCCGCGTTGAATCTTTGCAAGAAATCGAGCACGGAGGCAGCCGTGCCTTGAG
ACTGTAGAGAACAAGTAAACAGTCGGAATAAGTCCATGCACACCCAGAAATGAACGTAGCAAcagtgacgctgctgcatacCTTAAACACTGCCACCTCG
CGCTCAAAGTACGCTTGGTGCCACTCGAGAAACTGGTCTCGAATCTCGTCGTTGCAGGCGTCAAGTTGATGCAGAAGCACCACTGTCTCGCAGAGCTGTC
CACACCGAGCGACAAAATTCACCTCAATTGATACTCAAACTAACCCGTAAAACAATGCATAGCGTTACCTCCTCTGACTCGAGCGTCGAGTCAAGCATTC
GCTTCTTGAGCAGACGCTCAAGTTGCTGAATAATTTTCTCGGCTTCCGTTTGAATCGTCTAAAATTTAGTACAACCACGTCAGAGCCGCTCGAACTGCAT
CAATCACTATAGCAACCACAAAATACAAACTCGCCTTGAACGACGAGATATGTTGATATCTCCCCAAAATCCGACGCGCCAGAAGATAATACTTGGTAGC
ATTGGTGTACTCCTTCTGCTTGACAGCACTATACCCCCACAATGAGCAAAGCAACacaaaacacacacaaaaaaccATCCTACGTACGTACGTGTTGAGT
CTCTGAGGCAACTCGAAGATAAACTCGAATCTCTTCAACAATCGCCGCACACCGATGAGTTTCTCCACTTTGGAGCGATGCGGCGCCAACGCCACATTGA
TACTCTCGCTCTTGGCCGTGATGGTGTCCATACTCTTGACCACACGCCCCACTTCGTCCTCCATACTCGCCACATTGTTCTGCAACGTCAATAATAATAG
CGTCAAAACATTAATGTCAAAAATAGCAACGTCaaaaacagcaacatcaaaAGCGGGTATTTTTGACAGCGTCAAATTCCTTACCTTCATCTTGCGGATG
GTGTCCGTGGCGCtgatgaacttgttgtaGTTCTCGTACACGAGCATCTGCATGTTGGTGTCCAGCTCTTTGATCTCGCGGATTAGCTGATCGTCTGTCG
TGAGCAGGTCGTTGAGGCCGCGggtctccagcagctcctacGCATTATAGCAGACAAAGGGTTACACAGAGGGTTACACCAATATTATTGACATTGAGAC
GCACCTTGACGTAAATCTTGGGGTCGAAGCCAGGTGAGTCGATGTTAcgcagctgctcctgccTGCTCTCTTGATCTTGCAGCCCGTAGTagctgctcag
cagctcctgcatgCGCGTCATGCCTTGGTCTTCCATGGCGACGTGCGACGTCACTTTTCCCCGATCTTTGTCGAcaagtaccggtaagtaTCCCTATTTT
TGACAGTACGAAAAATGATGCGATATAATTGGTCAAAAAGAGGACGCCAATCCTTTTCGTCACACACACTTCATCTTGATCCCAGAGAGCCACGATCACG
ATGGACGTGAAGCGGCTGCTGTGGGAGTCCaagctggcggtggcgctgtgTCTGCTCATAATGGCACGCTGCGTGGACCGCGTTCTCTACACGTGCGTGC
AGCGCGTTTATGATTGCCACATACGCTGGTCTCTTGCTTACCTGTGgaatgtacatgtagacgaatCACGTACGACTACATGGAGTTCCTCTGGTACTTT
ACGAATGTGATCCTCCCTGTGGCCTTTCTGGTCTCATCGGCTCCTGTCGTGGCGTACGTAGGATTAATGCAATAAACTGCTACTATTCCTAGGTGCTAAT
GTTGTGCATTGCGCATTGTGCATTCGTCTCTCTGACAGATACAAACTCTATTTTACGGGTGGGCTTTCTTCCCTTTTATTTCTCTGAGGTGGTGGGTGCC
TTGTTCTCTTTGTTGCTGATTTGTGGGGtgaattgctgctgtagatgaCATCACGCAGGAGATGCGCGAGTTCCCGCACTACAAGTACATGCTCATGGCG
CTGTTCGACACGCTCTACAACCTGCTGGGCGCATTCCCCACGCCTCACATCGGGTGCGTCCATTGTGCTGCTGAAAATTCAGTGGATGGAGCCTTGAAGA
CTTAGTGTCGTGCttgttttgttgttgtgttgtTTTCTAATGGTGATAGGGGGAACATGGCCAATGTGCTGAACCAGCTGAACCTGCCGTTCAACATGCT
GCTGTCATACATGTTTCTGCAGACGCGCTTCAAGCGCGGCCACATCTTGGGCTCCATCCTCGTCCTGTACGGCGGCATGGTGAACTTGATCCCCGCTCTT
ACGGGTCAAGACAACGCGAACACCCCTGACCCGAGTGTGGGGTGGATTACGCTTTACATCGTGTCGCTGGTGCCAGCGGCGGCTTCGAACGTCTATAAGG
AGATCGGACTGAAGGACGTGGACCTGGATATCTGGTACGCCAACATTTGGATCAGCTTCTACCAGCTCATCATCGGCTCTGCCACGATTTGGACAGTGCG
CATCAAGGCATTCAGTGACCCTCCAGTGCCCTGGGCAGACTTCCCGTCCTATGTGGTCAAGGCCCACGAGTGTTTCATCGGCAATGAAGTTGAGCTGAAC
GGCAAGGTGTTGGCGTGTGATTCGGGTGTGCTGGAGGTCTTTTtgatcttcatcgtcttcaacacAATCTACAACCAGCTCATGCTGTACATCTTCAAGG
AAGGCAGTAGCGTGCTCTTCGTGGTCTCGTCCGCGGTGGGTCTTCCCCTCACCGACTTGCTGTACATGATCCCCATACTTACGGGCAAGTTCGCCGGTCA
ATCCTTCACTATCTACGATGGATTTTCTCTTTTCGTACTTGTGATAGGATTGCTCGTCTACCACTCGGAGAAGGAAGAGCGCAAGCGCGGAACCGAGTCG
GTGGAGAAGTCGCCCATGTATGCGTCGCCTTcactgcagaagacgcaTCTCATGCGCAAGCGCCGTGGCAAGGTGGTGTATCGCCAGAGTCCAATGATTC
GGCGCAGTGGAAGTGGCACCGACATTTCACAGCGGCTTCTGCGCAATGCCGCAAACAGGAACACCTACGGCTCCAATGGCAACACCACGGCACGCCAAAC
GAGCAATAACGGTTATTACCCTTGAGTTCGTCCGATAGCTTGTCTCCGGCAGCtttcggggggggggggctttTTTTCCTTCACGCCACAGTGGTGTTGA
GTAGCGTCAAAGTTGCTCTCGCTTTAATAGAGGATTCGTCTCGCTAGTTCTTGTGATAGATCATTATTGTGGCGTCTTCGCTCCGGGTCGGCCTGCTGGG
CGCTTGTAGGCATCAGGAGATAAAGGTGCATCTGAGGTGACAATTCGGCCTAGTGACGGGAAGTACCGATCCCCTTGCTTGCTGCGACGAGCCTTCACGT
TCACGTAATGGCCAAAACGATCAACATCCTGTGAGAAACTGTAGCTGCGGTTGagtccttcgtcttcggtaGGATTTTGCGAGCCTTCGAGTATCTTCAT
GTTGCAGCTCGGTAGCATTCTGGAATTTGCCGAGGCACAACCGGAATCAAATAGCGGGTCCAGCATCAAGCAATAGGCTGGGTCCTGGTCTCGTCGCCTA
GTTTTTGCCTTGGCCCTTGTGAAGACGTAGTGATGAGGATTatcggaggaagagcgcgGGTTGTTGTTGCCAGCAGGTCTTGTCGAGGCAATGTCCACTC
CATTCAAGCTTACAGGTGACTTCGAACCAGCTTCGAGAGTGAAGATGGAAGGAACGGAGCTTGACTTCGTTTCTAGGACCATCGCACAATTCGCCTCGAT
CGTCTTCCGAGCGACTGGGGATGGTCGAAGTCCGGTTATCTCATCCAAACGACCGACAGGTGACTGCGGGAGTGCAGGGAAGGATGCACGAGCGTCTTTC
TTGTGGATTGGACTACCCGCCACAGTTGACCGGCCCTTGGATCCAACAGCACTACTAACACTCGACTTGCGACGTTGCTCCTCCTGTCtctgttgtcgct
gctgataCTCGTTTATGAAGGCCATCGTCTCCCGAGCTAACTCGCCAACAGATTTCTTATCACGCAATGCCATGGGTTTGttttgcagctccatccCAAA
GTCGTAGCCGATCTGCTTTACTCTCTCCATCACCGTTGTCGACTTCACCGTTTTGTTATCTTTGCTACTagatttcttcttctcatcTGCTGATACTCGT
TCGAGATCAACACCCTTGACATTTGTCAAGTACGTATGATACTCGCCGAACGGATACGACGCAATGGAGCGGATGATCGTCACTGCATCGTACTGAAGCG
ACTCGAGGTGGGGGTTTGAATTCCCgtctcgtcgtagtcgaaCGAGGAATGGGAATAACAGTTCGACTATACCTAGCGCGACCACGCGGGGAACGCACAC
GAGCACATCTTGACTGAGCGCAGCGATAGCACCAACAGCATGGACCAAAAGCCTCCATTTTTTCACTTCATCCTTCTTGTTAGATGATGATGACACAGTG
CCTTGAGTGATAACAAGTTCCCTGTCGTGCTGTAGCACCTTCGTAAGTAATTCAAACACTCTGAAGTGCAGAAAGAGCTCACTTGTGCTGCCCTCCACAG
CGTTTACCATGGCTAGCCGTGAAATAACGACAGCGATTTCGCTCTTGCACTCATCGTCAAGGATTCTCGAGGTTGGATGTCGTAGCTGCATACGCTTGAG
AAGGCGAGGTAGAACCTGAGCACGCATTATCCCAGTTCGTCCATCTGCAACGGCACAAAGCTTGCCGAAAAGCGTGTAGAGTGCTGCGGGTACGTCTAAA
AGGCCATGGTCATCAACAGATGAATCAAACTCGACACTTTGACGCTTTGGCGAGGATTTCCCTGTTCCAGTCGCGATCAGAATCTCGGGCAAGTGAACCA
ACGCTGTCTGCAGACAACCTTGAGTGAGTAGCTTACTGCACGCAGCGTTGGTACAAGCTAATCGACTCAGAGCGACGCAACACGCGCTGACAAGGTCAAA
GCCCGCATTTTTTTCGCGGAGAATGTGCAAAATGGCTGGAGCGACCAGCCCAACGAGCTGCAACAATTTTTCTTGGGCGTATGTCGCATGTGGATGGCTT
GAGTGTGTCTTCAAAAACTTGTCTCGAGCACTTTCACCATAAGGCAGCGGCCGAATGTACCCCGCTAGCTCCACTGCAGCGATAACTTTATCAAGTTCTA
CCTCTGCAAATTCTGCTGCGTCACTTGGGTTTCGGATGAGCGCAATCAAGTCTTCCAGTACGTGCATCCGGAACATGACGTCGCAAATCAAAGCCTGAGG
CCACTCAGGCACCTGGGGAGAAGTAATAGATGGCCGAAGCCGTGCATCCACCATGTTGCTCGGACATCGTGCTAGCCGGCTGAGCGCCTTACAGGCCTCT
TTCGAACCAAGTTGATGTACGAAACGAACTTCCGGTGAACTACGCGCCACCAATCCCTCGATGTCATCTAGGCGGTTGCACTGAATTGAGAGCGCGAGAT
GATTGACGATATCCTCGGAGAAACAGGCACGCGTCACGTGGGTAGCTTTACACAAACGACCTAGCAAGATACAGCTGATGTTGCGCTGTCGAGAATTCTG
CACGGGTGACTCCATGCAACTCGGAGAGACTTGAGTTAGAAACTGCACGAGCGTGGGCAAGGCGTTGACCGAGAAAAAGTAAGCTGCTGTCTTCTCCGAA
GCATGTGGCGAGGTTTTATCTTGCAGCGCTAGGTCCAGCAAGAGAGTATACAACGAATCTAGTCGATCCTCGAAGTTCGTCAGCGCTACCAACAACGTCG
TGGCGGGCTTCACCTGCTCCGTTTGTCTTGCTAACAGCGCGCAGCCTATGAGGCCCATTACGAACGTCATGCGCGATTCGGAGGCATCGAGACTGGGGCG
ACACCAGCGCATAAAAATCTGCACAGCACCCGCTGTCGTGAGTCCGTGCCGGGCATCATTGCGGCTGGTTATTTCGTAAAATAACGTCACCGCTGCTTGA
ACAACAACCAAGTTGGCGTCTTTCATGCACAACAGAACTTGCTCAAGCCATCGACCTCCACATCGAGTGAGTGCATCAAGTAACTGAGAAAAGCCCAGCG
ACCGGGCAAGCAGAGACAAGATCTCCAGTACTTGCGCTCGCAGTATGTCCCCCTTATCTCGACAGAAGCTAAGAACCTCGAAAATCGTGTCAAAGACATC
GGCGGTGAGCAAAAATTGCCGCACTGCTGTCTTCAACTTTCGCATCAAGAAGTTCCGCTCCTCCAGAGTTGCAGCCTGAATTTCATCTTTCATAGGCGAT
GGCACTCTTCTTCGTGACGGACTTTGTCCATGGGGACTAACTGGGGTACTTGAAGCAATAACCGGGTGTCCCCACCGCTCTACCGCAAGGAGAACTTTCG
CGGCTATGGAGTACAGCAGATTGAGCGAACTTGTGAGCTcagaagaggaagcgaaTAAATTATCGCCGACACTTGTTTGCATGATGTGCGTCAAGTCCAG
TTGCACCCTTTGCACGAGATTGCATTGAAGGATTTCCACAATGTGCTCGTCGCCATGGCCTTCAGTGATCTCCGACACAATTCCCTTCACAAGCTCGATC
ACTTCGCGGCTCTGACGCCTGGTAATTAGAGATGAGAGACATACCAGCAAGCCCGATCCAAGGATACGCCTCTGATCAGCGAGCACGGTACTGCGAGTCT
TGTCCGATATGGAGTCACGTCCGCGTTGTAGCTTCACCAAATGGTGCAAAATGGTTATGTATGCCTGGGTAACGCTGCTAGGGATTCCTCCGGGTCCAAC
AGCTTCCCGAAACATCTTGAActggtggcgcagctcaacAAACTTGATCGTGTGCATCGACCGCAGACGAGTTCGCACGATAGGGTCGCAATCGCGCTGG
TTCAATGTGCGCTCGAAAAGCACTCCGCGCCAACGGTGTTGAAGGATACGCGCACACAGCTCCGTTTCGCGCAGCAAACACCCGATGCTTTTATTCACAG
CGTTTTCGCTTGACAGGACGTGCGCAAACCACTCAGCTAGCACTGCTACAAGTCGAGCCATACGGAAAATCTTGGTATTGTTTGTGAGTTTGGAGAGCGT
CCGGAATGCCTTATTGGTAAGGCTTGGCAAGGAGGTCTCCACATAGTCCACggcgtctacatgtagaacacGAACACAAAGCTGAGTTAACAACCTTTTC
TAGCTCGTAGTCGACATCGACTACAGTATGATAACGTACCGACCTTCGTGAGTCTCCATCAGACGGAGTAGCATCGTAGTGGCAAGCTCGCGTCGTGAAT
CGTCCTCAGAATGCTCAATCTCCTCGTACAGGGTCTCCACAGCGGTCTGGATCTTGGTTGTGTTCCACGCTCGCGTATCCCATTCCTGGTCCATCAACAT
TGTTGCCTAGATACCACCACAAGTATTacatcaacaccaacacACTTACTATATCAACATGGCCAGGTTTACTTACAATTCGGCCATCCGTCACAACGgg
gtcttcttcctcttccacTCGATCGGGCTCGCCTgtatcttcttcatcgaagTCTGGAGTGATTTCAGAGAATCGGCTAGGAATCACACGCTTTGGAGAC
TGCGTTGGGCTCTTCTCAGCTCCATTCTTCGTGCGCGACTGCTTCGTAGCGTCACGAAGGATCAAAACATGGCGCCCGACGTCCTGAAGGTGTTCGCTTG
CTGCGGGGTCCAGGGGTCGATCAAGCGCTAGCGTCGGTAGCAAATGCTCTTGCATCGCGTACACGCGCTTCGCCTCCGCGTTGACCTCCACCGCGCGGTC
TATCGTAGAGCCACGTTCGTCTTCCCATGGGTTGGTCTTCTCGTACGGCAGCGTGACCTCACGCCGCTGGCCACAGCGAGAAATGCTCGGGTTCATGGCC
ACTGCCAAGCAAAGCACAACAACCAGACGGAAATAGGAGCTCGCTATCAACATGACAGGCATCAATCATCAAACACACGTTAGGAAGGACAGTTTCATCA
TGAATGACCTTGTATTGGAATACATACTTCGACGCCTCCTGGTTGTCCAGAATGGCTGGTCTGCAGTTGCTTGTaactgtgtgtgtgtgtgtgtgtgtct
gAAGAGCCTATAACCAATGACTTGAAGCTGGTAAAATAAACTCCTTACTTGCCGCCGAAGAACTTGC