Description :
From Genome Similarity Track
Location :
Scaffold_53:85083- 91661
Transcript NameFunction/comments
Hyaar_Emoy2806628necrosis inducing-like protein NPP1 type

Sequence
6578 bases(100 bases per row)
CCACATCACACTATCACACGCTCTTATATGCGGATAGTAGGAGACTTTTCAGCCGTAACATCGATATGAAGTGTGAGAGTTAGTCGGGAGAAAGCTGCTG
ATTCGTTTCTTTCCCACACCTACTTACCTGTCCCTGGCTGGCTTCTTCGCTTTCGGTAGCCGTCCTCGGGTTTGTAGTCCAGAAGTAACACCCTTTCTAC
ATCATTATCGATCATAATTCGCTCAAAGAACGCGATCCATCGCTGTGGTATTCGAAATACAAGTTGGATGACAAGCCCAATTACGTCCCTTCCAGCGCTC
GCCACACAAAAAACGAACGATAACGAGTACAAGGTTGAAGAGTAAGACAAGACAATGAATTAGAGAGGGAGTTTATCTGCTGTGGACGATACCTCGGTGA
CATGGTTGTCGGCTAAACGTTGGGTGCTTCAGAAGCTCAAGGTGAAGATCGTCACTGACATTGTATACGAGATTAGGAAAGATGCGTACGCGGCTGAGCG
AGGCGTATACATTGTTGATTTTGGCCATTCTATTGAAGACGCAGGTTAACATCTCGTTTTAAGATCTGGGTTGTGTTCAGAATTGTCAGTACGTGTTGCA
CACCAGGCGATGTTGAGAGCAAATTGTGGGGGGATAGAGGAGGGCAGGGCAGTGTGCTATAGACACACCCTTACGTGCTATCGGGCACATGCGTTTTAAT
GGCAATTCGAGGGTGCACTGATCGCAGATCGTCGTTGAGGGCGGGGGTGGGATTAATGTGGTGGCGTGGTACGCCTTTAATTGTTCAAACAAAGTCATGG
TGTGGTAGAAATAGTAAAAAGTGTGGTGGAAATAATATTTCCCTAAATAGTATGGATCCGATCCGACCACAAAACAAATATATTTCTTTTGTAGAGGTTA
TTTACCAAACAAGACTAATCGAAAACATTCTGAGCTATTTGCCCTGTTACGATTGCATAACCTAAAAAACATGCTATGCACATACGATCACCATATGCGA
TGTGTAGCGTGTTCATCCCCACGAAATGAATGCAAAGAGCGTGCCATACGTTGCATATGCAATCTGTTTGTGGTATGCTCTATACGATTCCGTGCTCTAT
TATGAGCGTTCGACACCTCCATGGATTTGTAAACGAGGGACTACATTGGTCGTAACTTGTAAAATCGGAACTGAATAGAGCACGCAACTCATCACTGGAG
AGTCATGTGCATTTAACAATTGAACGTTCTGCGGAACTTGGTGTCCTCCAGCAATGTAGCTTTTGTTCATTGTACAATTCATCGGCTAGAAGACACAACG
AATCAACCATGAGGACTGGCGCCTTCCTGTATCCCGCTCTGCTCGCAGTTCTGGTCCCCGTTTCGAGCCCTGACGGGTGTGGGACTGAACGAATCCCTCA
CCACGAAGTGAAGGCGTTTGCCCAGCCGGAGCCCGTGACAATCTCCGAGAAGGCTGCCGTCAGACTCAATCCGACTCTCCTCGTTACTTACGGATGCCAA
CCGTACCCTGCAGTGAACGAGTTTGGTCAGACTAGTGGCGGTCTCAAGCCTACCGGAGATCACAATGGTCATTGCAAGGGCTCTGGGCACGGGTCTCAAG
TCTACGCGCGTTCAGCTTGGTTCGGGGACAAATGGGCCATTATGTTCGCCTATTACTTCCCAAAATCCCAGCCGCGTCGAAGTGTAAGCGTTCGTCACAG
CTGGGAGTTCGCTGTCGTCTGGATCGCCAATCCTGAAGCACCAGAGAAGACTCTGGCACTCACAACGCGAAGCTTCGCCTATGGGTACTTCAAGTACACA
TCATTTGACGCAAGCGAAATGGACGGGGAGAGAGTCAAACTCAGATACTGGCAGCATGCGGACTCTGACCTTTACTTGGAACTGACTAGCCTGGACGGTG
GTGTAACCCGACCTCTGATCATGTGGGAGCAGTTGCCAGAAAAAGCCCGGTGTGCGCTTAATGAGGCCACGTGGAATGGTGGGTTCAAGTGCCCACTCAG
TGATGAGGCTTTTGAACCGCTTTTGAACGCTTCTTGGCCTTTTTAATGAGTAGAAGTGATCTGGTGGACGCTGTTTGAATATTGCTGCATCAAAACAACA
TGGTAGGAATTTACCTGACATCAGCTACGGACCTTCAGGGGCAGTTTGGTTGGCGGAAGCACATGGTAGACATTGTAGCGCATCATACACGACTGTATAA
CTTTCAAGTGACGTATGTGTTGTTGGTTAGTCTTCCGACGGAATCCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN