Description :
From Genome Similarity Track
Location :
Scaffold_199:85078- 88242
Sequence
3164 bases(100 bases per row)
AGTGTCCGATGGAGGAATTCTACAACCAGATCCGCCAGTGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTA
GGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCCGATCCC
TAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGAGTTTTCCAGATCCGAAGTCTCTTC
AACCCTGGATCTACAAAGGGAAGAGGCACGTGGTTATTGGGAGAAACGCCAACATGGTCGATGATTTGAGCCCACAAAGGATGAGGTCACTGCAGATCCA
CCTAAGGTCGGTCAGGTTACTGGATCCCGTGGATCGGACGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCC
CAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATAAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATAC
AGCCTTTGCTCGTGAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTAGGATTGGTGAGGGCGTGTACCGTACGAATGGGAGAACGCGA
ATCAAGGTCACGTTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGATCAAGACGCCATCCTCGGGATGGATTTCATGGTGC
CAGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGTCGTTGTATGGAGCGAAGAT
GAGGATCATAAGGGCGGATAAGACAACCTGGATCGAGCCCGGGGAAACCTGGGAGCTGCCAGACCGATTAAAGTGGGTGGAACATGAGAAACGGTGGGTC
ACTCGGGGCGAGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACC
ATTCTGAGAAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCT
GGCGTACGAGGCGACTACCGAGATCGAGTCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCG
CGAACGATCCTGCAGAGGAATCGTCGGATCGAGATCCAAGCGATGGAGGTTGGATCCACGACGGGGGATGATCCCCAGAGTCGTCCCCTAGATAACGCAG
GATCGGTGGATGAGGGATCGCAGAGGGCTGAAGCCGGACCGCCAGATCCCGCTGACCCCAGAGTGGATCCTAACTTTTCATGGGGCCAAGTGTCTGGATC
CTTGTCGAGAGTGGCCGCACTAGCTAAACAGGAACCATCGTGGGTAAACCCACCAGAGGATCAAGTCGATCCAAAAGGTGGCTTCCCCAGTACCAGGATA
CCCGACCCCACGAAGACAGAAGGGATGACGGTGGAAGGAGAGTCGCGGTGCTTGGATCCAAGGGTGGATCCGACAAAGACTGAAGATGAACAAGTCTGCT
ACCGTGAAGGCGGGGATCTACACGCCGAGGATCTTGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATAT
CCAAGTGGATCCAGAGGCGAACGAACCCGCTGAAGTGGATCGTCTACGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATCGGTAAAGGCAATGCGTTA
CCACCCGCCGCCCGCGGGGTCAAATGTGACATCGATGTCGGCAACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAAC
TATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGCTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAGCGGGGT
GGATATACGTCTGTGCATTGATTACCGGCTGGTTAACAGCCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGAT
AAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGCGGTTTCTGGGTAGTTACTATGACGGATCGAGCTCGCGCAATATTCGCATTCATCACACCGTTTG
GCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAGCGCACTCCAGATCTACCAACGCCGGATCGATAACACCCTCTATGGGTTCACCCGAATACC
GGAGCCCGAAACGGGTGGATCCGGGGAAGGCAATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCGTCTGTGTTAGGACGC
AGATCTTACATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGTTGTGTGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCT
CTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAAGGATTGGAGGCGAATCCTAATGACCTGTC
TTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTGGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTG
TTTGCCGCGTTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGCCCGGGAAATGT
CGGATCCACGGAGGGATCCAAGTGGTACGACGTCAGAAAAGACCTAAAAAAGGAGCTGGATCCACCCCGGGACCATAAGAGAGAGGATCCAGTCTGGATA
GAGACGACGGATCGGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCC
TCCGTCATTTCGATCCGGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACTGGGCAATCTC