Description :
From Genome Similarity Track
Location :
Scaffold_786:8507- 10217
Transcript NameFunction/comments
Phymu_g11964hypothetical protein
Phymu_g11965ATP-binding Cassette (ABC) Superfamily

Sequence
1710 bases(100 bases per row)
TACTCCAGCTCAGAGTGCACGGGTTGGGGGTTATACGGAGAGGTTTGCCTgcgatggcgctgctctTGGTAGGGCTTTGACCGGTTGATAGCTGAATGGT
GGGAAGGACTTGAAGGGGGGACAGACCAGCACCAGTGTCTTCGTCCATGCTGCGTCTGTGACTACTTCTGAAGTGAATAAAATAGGAAATGCGAAGTTTA
GGATGCTTGTATCGATAGGAATAACTGTCTTTGAATAGTTGGAAGCTTCAGTCTCGTTTCACAGTGCCGTTGACTCACCCCCAACGGTAATATGCAAGAG
AAGAACTTTACTATTTTTAAAAAGATTTAAAAAAGTGGAAGGTACGTCTACTGTAGAATTATCTCGAAACGATATGAAACATCAAggatgaagttgaagc
cttTTGGTTAGTTACACTGTGGAAAATTACGTTTAAAAAAACATATTTCGTCGTCTCAAGAGATATTTTACTTACCTACtaatcttttttttttaatttt
gGAATATCTCGGAACTACCTACGACCGGTGTGGAACTTGTAGAGGATGAATGTGAAGATGATCTCCAACCCAATCGCGTAACATGCGAGGATGATCATAT
TCTCCGTCGTGTCAACGTTCTCGAGATTCAGCCGGACCAGAATGGCCTTGGCCGATGGGGTATCTACGTGGATGAAGTGCTCGTACACGAAGGACTTGAA
CGAGTACGTGTGGAAGGCGAGGTAGTAGGCCCAGATCCAGTAGTCCGGGATCGTCTCCTTGGGCACCATGAAGCCTTCGCAGAGCATAAACATCCCGTAG
ATTCCCGCCCCCAAGGCGATGCCGATGATGTAGTGCGGGACCGCAGCACCAATCACGTGCATCAACGACTCCGCTACTACCAACGACAGGAAGAGATTGA
GGAGGAAGTAGCCGAATCCATGGAGACCCGAGAGTAGAACCACCAGTAGTGTCGATACCAAAGCAATCAAGAAAATACCTGGTAGAGTAGCGATGAAGTT
GGATAGtgcgaagctgaagacgttgagACCGCTATTCGCTCGTTCTCGTAGGAAAACAGCGCGCTGTTCAATGAAGAACGGTAGAACCGCGACTGACATG
AAGACCAGGAAGGCCTGCACGTAGAACAGCAGAGGCACCATGTCTTCATCCGAAATGTCGTCGTTAGTGGAGAGGTACATGGTACCGACCATGAAGGCCA
GCATCGTGTACATGGCAAGTCGAACCCAGTAGATGCCAGGGTTCCGCACGTTGTTGAGTGAATTGCGCTGCATTAGCACCACAAACTGGCGAAAGGCTGA
CGGTGGCACTGGAATgactggcgctgcagtgTTTACACTCGCAGCATCATTCTCGATCGCTTGAGCTACGTCCGTTGCCATTGAACTGGTGGAATAACTG
TTGATCAGTTTCTTGATATCCGCGTGGCCTTCGAAGTCCGAGTTCACCAGACTGATGAAGTACTCGGCCGGGTTCATATACATCGGGCAGGAGTGCCCAG
AAGCCGAGAAATGGTCGAGAATCTGAGTGCGAGGACCAAAATACACCGTTTCACCTGCAGTGAGGATCACGACGTTCGAGAACATCTCGTACACTAAAGA
CGAAGGCTGGTGGATGGTACAGATCACCGTCTTGTTCTCTCGACACAGTTTAGATACGAATTGCATGACGTTGTGAGTAGAAGCCGAGTCTAAGCCAGAA
GTCGGTTCAT