Description :
From Genome Similarity Track
Location :
contig_12:850679- 851705
Transcript NameFunction/comments
g4104.t1KUG00810.1 hypothetical protein AM587_10008647 [Phytophthora nicotianae

Sequence
1026 bases(100 bases per row)
CCGACGACTTGGCGCCGAGCGCTGCTAATCGATGGGTGTTCCCCTTCTCTTGACTTGCACCTTCAAAAACGATGCCTGCATGCTTGTTTCCCCCTTTTTG
CGTTGCTTTAGAGGACGATGAAGAGAGCAGCGACCTGTGAGCACCGCCAGAACCAACTCGCGCTGGATCAACACTGCCGAAAGTACCAGATGCCAGTCCA
GTGGGCGGTTTTAAGTGAGGTGCTGAGCTGGTCAAGGCACCACCGCTCTGCAGTCCAGACGATGGGAGTCCGTCCATATTCACGCTTCCAACGCCAAGTC
CTGGCTTAGGAGCCCCGAAGGCTGCAGTAATGAGCTGAGCAGGTCGCTGTTGCTTTTGTTGTGGAAGGTTAGCCATAGGCAAACCCACGTTCAGAGCCAC
TTTGTTGTTTGGAGGCGTACTGCTTGGTCCAACATCCTCGACAACAACCGGAGCCCTCGGTTGGGCTGACCTCAAGCGGTGCATGACAACCAAAGCATTC
ACGCCTCCGTCGTCTTCCTTCACAGCTCCAGCGCCGCGTTCGTGCACACTGGTTAAGGGTTTTCTTTTCGCCGATGTCGTTCGAGACTTGGCGCTTGCCC
CTCGCAAGCCAGCGGCCGTCTTCGGGTCTGTCTCCTTATCGTCGCCCTGACCTCCAGAAAAGCTACCGAAGCCTCCTAAACCGAAGGCCCCGAGCGTAAT
GATACTTGCACGTCGCTCACGTGACCAAGGCCTGTCATCCTGGACGGGTTCCGGTACATTGTTGCTTTCCAGAACTTCTCGAGATGAACCACTAGGCGGT
GGGGTCTTGGCACGCATAGTTTGCAAAGCTTTTGTCGCTATAAACCCCAATGAGTGCGTGGGGGTCATTGGAGGCGGCAACTGCACTGGTACGTTGTCTT
CTTCATCATCGCTCGAGCTTCCATCGCTTGTAAGTTCTTCTCCGTCGTCGACTTCAGACGGAGATAGTTCTTCTGAAGAAGACGACTCTTCTTCGTTATC
TATCGCCTTAATTGCTTGAGTGGACG