Description :
From Genome Similarity Track
Location :
contig_12:850493- 851519
Transcript NameFunction/comments
g3924.t1KUG00810.1 hypothetical protein AM587_10008647 [Phytophthora nicotianae

Sequence
1026 bases(100 bases per row)
TTTGGATGGTTGGAGAGCCCGACGACTTGGCGCCGAGCGCTGCTAATCGATGGGTGTTCCCCTTCTCTTGACTTGCACCTTCAAAAACGATGCCTGCATG
CTTGTTTCCCCCTTTTTGCGTTGCTTTAGAGGACGATGAAGAGAGCAGCGACCTGTGAGCACCGCCAGAACCAACTCGCGCTGGGTCAACACTGCCGAAA
GTACCAGATGCCAGTCCAGTGGGCGGTTTTAAGTGAGGTGCTGAGCTGGTCAAGGCACCACCGCTCTGCAGTCCAGACGATGGGAGTCCGTCCATATTCA
CGCTTCCAACGCCAAGTCCTGGCTTAGGAGCCCCGAAGGCTGCAGTAATGAGCTGAGCAGGTCGCTGTTGCTTTTGTTGTGGAAGGTTAGCCATAGGCAA
ACCCACGTTCAGAGCCACTTTGTTGTTTGGAGGCGTACTGCTTGGTCCAACATCCTCGACAACAACCGGAGCCCTCGGTTGGGCTGACCTCAAGCGGTGC
ATGACAACCAAAGCATTCACGCCTCCGTCGTCTTCCTTCACAGCTCCAGCGCCGCGTTCGTGCACACTGGTTAAGGGTTTTCTTTTCGCCGATGTCGTTC
GAGACTTGGCGCTTGCCCCTCGCAAGCCAGCGGCCGTCTTCGGGTCTGTCTCCTTATCGTCGCCCTGACCTCCAGAAAAGCTACCGAAGCCTCCTAAACC
GAAGGCCCCGAGCGTAATGATACTTGCACGTCGCTCACGTGACCAAGGTCTGTCATCCTGGACGGGTTCCGGTACATTGTTGCTTTCCAGAACTTCTCGA
GATGAACCACTAGGCGGTGGGGTCTTGGCACGCATAGTTTGCAAAGCTTTTGTCGCTATAAACCCCAATGAGTGCGTGGGGGTCATTGGAGGCGGCAACT
GCACTGGTGCGTTGTCTTCTTCTTCATCGCTCGAGCTTCCATCGCTTGTAAGTTCTTCTCCGTCGTCGACTTCAGACGGAGATAGTTCTTCTGAAGAAGA
CGACTCTTCTTCGTTATCTATCGCCT