Description :
From Genome Similarity Track
Location :
contig_118:85034- 86233
Sequence
1199 bases(100 bases per row)
GGTGAAACATGGTTGCGTACATAGGGGTACGTGGCGATAAAGTCGGGGCGTCCATGCTACAACTGGAAGTGTTGATAAAGTGTGCTGGGGCCTCACAGAG
CGAGTTTTGACAGGATTTGCGAGTTTTCGGTCAGTGTGGAGGTCACTTCTGGACGCCGGCAGAGAGCGCTTGCTGCTCACTGGCGCAAGATAGTATAGCA
GGAATACCGAAGTGGATGGCGTGCGGGAGTGTACCTCAGGTGGGCGCGAGCACGACATTTCCGCCTGGAAGCGGATTTTGCTGCTTTTTGTGACGGCTTG
ACTGCGAAAGTGTACTTGTACGAGTACTACATGGCCAAAAGCAGGTGAAACATGGTTGCGTACATAGGGGTACGTGGCGATAAAGTCGGGGCGTCCATGC
TACAACTGGAAGTGTTGATAAAGTGTGCTGGGGCCTCACAGAGCGAGTTTTGACAGGATTTGCGAGTTTTCGGTTCAGTGTGGAGGTCACTTCTGGACGC
CGGCAGAGAGCGCTTGCTTGCTCACTGGCGCAAGATAGTATAGCAGGAATACCGAAGTGGATGGCGTGCGGGAGTGTACCTCAGGTGGGCGCGAGCACGA
CATTTCCGCCTGGAAGCGGATTTTGCTGCTTTTTGTGACGGCTTGACTGCGAAAGTGTACTTGTACGAGTACTACATGGCCAAAAGCAGGTGAAACATGG
TTGCGTACATAGGGGTACGTGGCGATAAAGTCGGGGCGTCCATGCTACAACTGGAAGTGTTGATAAAGTGTGCTGGGGCCTCACAGAGCGAGTTTTGAAC
AGGATTTTGCGAGTTTTCGGTCAGTGTGGAGGTCACTTCTGGACGCCGGCAGAGAGCGCTTGCTTGCTCACTGGCGCAAGATAGTATAGCAGGAATACCG
AAGTGGATGGCGTGCGGGAGTGTACCTCAGGTGGGCGCGAGCACGACATTTCCGCCTGGAAGCGGATTTGCTGCTTTTGTGACGGCTTTGACTGCGAAAG
TGTACTTGTACGAGTACTACATGGCCAAAAGCAGGTGAAACATGGTTGCGTACATAGGGGTACGTGGCGATAAAGTCGGGGCGTCCATGCTACAACTGGA
GTGTTGATAAAGTGTGCTGGGCCTCACAGAGCGAGTTTTGACAGGATTTTGCGAGTTTTCGGTCAGTGTGGAGGTCACTTCTGGACGCCGGCAGAGAGC