Description :
From Genome Similarity Track
Location :
contig_105:85031- 90087
Transcript NameFunction/comments
g11098.t1hypothetical protein
g11099.t1hypothetical protein

Sequence
5056 bases(100 bases per row)
TGAGCGATATCGGTCGCAGCGTGCGAACGTCGCGCAGGACGAAGAAGATCCTGGCGACTACCTTTTCTCGGTTGGTCGTACGAGCAGTACCGCCAAGCCG
AGTGACATGTGGCTGGTCGACTCGGGTGCGACGCAGCACATGACGAGTTCCAAGACGTACATGAGGAACTACAAGACGATGGCTCCGGTGGACGTGCATC
TCGCGGACGACGGTGTGGTTCAGGCGGTGGGACCGGCGACATTGTCATGTCGATGAAGACGCCGCGCGGCATGAAGAAGGGTGTGCTCACGAATGTGTGG
CATATCCCGAAGCTGTCGCGCAACCTGTTTTCGGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTTCGAGAGCGACGGGTGCTTCGCGGACAACA
AGGGTCTCAAGTGGCAGCTCGGCGCTCGTGAGGGCAAAGGGCTGTTCAAGCTGTGCATGACTCCGATGATGCCTGACGAGGCCAATGCGGCAAGTTCGAA
GGATCGCCAAGGGGACACCACGTCGTACCTCTGGCACCTCCGACTTGGTCACATTGGCCATGGCGGTCTAGACGCCATCGTCAAGAAGAGCTACGGTGTT
GGCATCGACATGACGTCGGTGAAGCAGTGGGAGCTGTGCGACGGGTGTGCACTCGGCAAGCAAACGCGAGTGAGCTACATGAAGTCGTCCCCGAACCGTG
CGAAGCACGTGCTGGAGGTGGTTCACAGCGATGTGTGCGGCCCCATGCAGACGCCAACGTTTGGGGGCAAGCGCTACTTCGTCACGTTCATCGACGACAA
GTCGCACTTCTGCGTCGTGTACTTGCTGAGGAACAAGTCCGAGGTGGCTGCCAAGTTCGCGGAGTTTGTGGCGTTTGCTGAAACTCAGACCGGCAAGCGC
GTGCAGACACTCCGGAGCGACAACGGTGGCGAGTACACTTCCGGCGCGATGGCCAAGTTCTGTGCGGACCGCGGTATCGTGCAGAAGTTCACTCCGCCGT
ACACGCCTCAGCTGAACGGAGTGGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGGATTGCCCAAGACGTATTG
GGGAAGCGGTGATGACGGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCGTCAGCCACGACAAGTCTCCGCACCAAGTTTGGACGGCAAGAAGCCG
CTGCTGCGAACCTGAAAGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCGGTGCGCTGTCGGTTCCT
GGGGTACTCGGAGCACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACGTCTTCGAC
AGTGGGAGACGTGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGACAACGAAG
AAGAGGAAGAAGAGGAAGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCACTGGAGGAAGTCACGGAGGTTCCAAG
TGCCAAGCGGTATGCGTCGCAGAGTCGACACCAGACGCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTCGTGGAT
TCAGTGGGAGAAATGCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTCGCTGCTCA
AGAACGACACGTGGGATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAGATTGA
GCGGTTCAAGGCGCGACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCCATCCGG
ATCGTACTGAGTCTGGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCTACATGG
CACAGCCGGATGGCTATGTGGACGAAGACCACCCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATGTGGAACCA
GACCATCGACGACTTCATGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCCAAGACATGATCTTCGTGGCG
CTGTACGTCGACGACTTGGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCG
AGCTGGAGTACTTCCTCGGGATGGAGATCAAGAACGACCGGCTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCG
GCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACACGATGAA
GAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGTGGGAGTGCTGAGCCAGTTCTCT
GCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCC
TTGGTATGTGCGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAG
CTGGAGGAGCAAGAAGCAGCGGACGGTGGCGCTGTCTTCAACGGAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGAGGCAGTGTGGCTCAAGGTGT
TCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAA
GCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGTTTCGACAACGACATGCTGGCGG
ACATGATGACGAAGGCATCCTGCAACGCAGTTCAGTGTGCTTCGGAGCAAGCTCGGGATCCAAGGTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCA
AGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACGCTGATGAT
GGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAG
TCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGA
ACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAACCCGACCAAAGCCTTTTCTTCGCAAGATGATCGACAACGACATGATCAAGGACGCGAAGG
CACCTTCCAAGTCGAGTGGACCAAGCGTGTGTCGCGGCTGCCAACAAGGGAAAATGGTCCAGAAGCCGTTCCCAAGCAACCGTGACAAGCGCCGCTACGA
CACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCTCTGGGTGGCAGCAAGTATCTGCTGCTGATCGTGGACGAAGCCAGCGGA
TGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGT
TTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCA
CCAGACCAACGGCACGGCATAACGCGCCATTCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAG
GCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTGA
AGCACATGCTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTT
GACGGGACGCTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGAT
GGGCATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTTAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGT
AGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAGCCTTTTGGTTATGAGCCCAAGCCCCGTCTTCCCT
GCCCAAGACCAAGACCCCGACTACGCCTTCGCCATGGACGCCACCCCGACCGCGACCGCCCGCATCAACAAGTTCAACGGAACCAACTTCCACACGTGGA
AGTTCAAGATGCAGATGGTGCTCGAGGAGCGCGAACTGTGGGAAGTGACGAGTGGGGAAGTGAAGCTGGAGCACTGCACGACCACGGCGGATCAAGCGAC
GTTCAAGAGGAAGTCGCGTAAGGCGCTGGCGATCATCTGTCTCGCGATGGAGGACTCGCAGCTGCCGCTGGTTCGCTCGGCCAAGGACGCGCATGATGCA
TGGTCAAGACTGGAAGGACACTTCGAGAAGAAGAGTTTGGCCAACAAGCTCTTTCT