Description :
From Genome Similarity Track
Location :
Scaffold_21:85020- 88278
Sequence
3258 bases(100 bases per row)
GCCGCCCCGCCATCTCGGCAAGCTGTGCGAGTTGTTAAGCATCTTTCTTAGAGCCGTGCTCATCGTTTTCTCGGACAGTCCATGGCGTCGCCGATCGTGA
TTGTTATGAAAAAGAATGGTCTCGACATACGACTCTGCATCGATTACAAGATGGTGTCATCACCGCAATCATGGAGTTTGCGATGCCGTTAGTGGACGAC
CTGTTGACAGATCTCGAGAGCTACCCATGGTTCTGCTCACTGGATACTGCCAGCGGCTTTTGGGTCATCATGATGGTACTACGAGCGCGTTAAGTGTCTG
CATTCGTTTGTGCACTAGGGCACTTCGAATGGCTGCGGATGCCTTTCGGGTTGAAGAACACTTCTGTGATATACCAGCGCATGATCGGCAATGCGTTGTG
GGCGTTCGTCCAGCCTAAAGGAGGATGACGTAAATATTCGGAGCTGATGAGTGCAGCTGAAGAAAAGGCCAAGGAACGTCGAGCGACCAGCACCGATGGT
TTGTTTCAAACCAAGCTCAAGGTAGATCGCAAAGTATCAGTAGACACTGCCCCAGTAATACAACTGGTCAATGACCCTATCGCCGATATGTTTCAGAATG
GGGAACCCGACAAATCAACGTTGGTGCTAGTATTCGGTCGTCGGTCGCTTGTCGATGATATCTGCTTCGATGGCGAGGATTTCGATGGCTCTAGCGACAC
TAGACCGACTGCTTGCTCGATTTACAGAATGTCGGATAAGTGCCAGTTCTACCAAGAGCATCTTCTACCAAACAAAGGTAGACTTCCTGTCACATGAGGT
CTCGCCAGAAGGAATAAGGGCTGACCCGAAGAAGATTGCAGCCATCACCGAGCTGTCGTTCCCAACGACCAAGCGAGGGATGCAGTCATTCCTTGGGGCA
TTGAACTACTATAGCCGATTCATCCAAGATTTCGCGGTCTATGGTGCAGCATTGTACCAACTGAAGGAGGAAGACTTTGGGCTGAGCGGCGGTCTCTCAG
TCCCGAGCATTCGCGACACTACAAGCGAAGGTGGCCGAGGCTCCAATCTTGAAGCACTTCGACCGAGTTGATGTGATGCTTTTCGCCAATGAATGGGCGT
TGAGTACAACACTTATGCAAGAGCATGAAGACAAGCTACACACCGTACGATTCCTCGGTTGAGTGCTCAAGGACTCTTAGATGAACTACCACCCAGCGGA
GAAGGAGGTACTGGCGCTCCTTTTGTCCCTGAAGACGCGTTACACGCAGCTTGCTGCGAAAAAGTTACACGTGTATACAAGGTTTTCGACACTAGCCTGG
GTCCACAAGTCCAAGTCATTGTTCGGTCGCGCCGTACAATTTGCAGTACTGCTGTCACCGTGGCACCTGATCGTAGAACGAGTCAAAGAAAAGGATGTGG
CCTTTGCTCAGCTACTCCAATCCACTATCACAAACTTCGTGGATTTGGAAGAAACGTTGGCGCCGTTGGCTCCTCCAAGCAAAGGCTCACCGTCGATTCG
CGTGGACTCATCTTTGCTCTACGCGAAGCTACCACGCGACTACCGAGAATTTGCCTTATCGTTCGATGGATTTGCAAAGACAGAGAAATATGGTGGTTAT
GGCAATTGTTCGTGGATATCACGGAGTCTACCGGAGTGGAAAATAGTGATCGCTGCGAATGCTTACTTCCCGTCTACTACGGTAAACCTAGTCACTGTAG
GTGACTCGAGACTCGCGATCCAGCAATCACTAGGGGTGATAGCATGTCGGAAGGAGTCCCTGATGGCACTACCGAATACTCACAAATAACTCGCGGTGAA
GCTACGATCAGTCAAATACCTTCAAGTTGTGCTAGAATACAACGCTGCCGCAGATTCGCTAGCCACCGAGGCTTTGGAGTCGAAAGCTAGTCGAGTCATA
TTAGCCGAAACGCAAAAATCGGGGTTAGTGACGTTGAACCGCATTCAAGAAGTGATCTACGAACTAAATGAAGACTCAGCAGAAGTTGGGCCACATCAGA
AAAAACGCTGTGTACATGTGCTAACCGGCAACGCACGTTCTCCACGCAAGACTTTCGAGAAATTCGTGAGTGACGACAATTCGAGCAAATTGAACATATT
ACAGTAAAGACCAGACGACAAGCCAAAGCTAAACGTGTTCGATTCGCCGATGAACATTCGGAGCAAGCACCTAAAGGTCAAGAACAGGGTAAAGAACGTG
ATGGAGTGGTCAACGAGCATTCTCCCGATGACATTTCACGGGATCAACCCTCCAGCACTAAGCGGACGTCAGTACCTGGTGCAGACGATGTCGACCCAGT
AGAGATACAACGAGAGCGACGCCGACAAATTTCCAAGGCGCAAGACGAAGAACAGAAGTGACCAAACCTGAAGAAAGTGCTTTGAGGAGAGGCAGAGCGG
ATGAGCTACAAGGAAGCTTGAAACGCATGGAAATACGCAGACCGATTCGTTCAGTCAGAAGATGGTGTGCTTCACTACCTGGGTTTGAACCAAGGATGCG
ACCACGGGTGGCAAGAGGAGGCCAAGCTGCGTCTAGTGGTACCTACCACGATGGTTCAAGAAGTATTACAGAAATGCTACGACTCGTTGGGAGGTGGTCA
TCAAGGCGTCGCCAGGACCTTCCACCGTGTTGAGTCCGACTATTTCTGGTTTGGGTTGTATGCTGACGTGGAGAAACATGTGAAGTCGTGCCTGGATTGC
AGCTCACATAAGAGTCGTCCACAGTTGCGAGGATACTCGCCAGGCAATGTACTGGCCGAACAACCGTTCCAGATTGTCTCTATGGATTTTGTGATACCTC
TACCAAAGACACGCAGGGGCAACACTACCCTGTTGCTATTCCAATGCTCGTTCACTGGGTTCGTTATTGCTAAGGCCATGTCCGACACATCTGCACTCAG
CGTAGCGCGAGTGTTCGAAGAGTGTGTGTACCGACGGTTCGGAGCACCATCGTTGATTCGGCATGATCGAGACCCCAGGTTCATGAGTGAAGTTTTCCGA
GCCTTCGCCGAGATGATGCAGCCACGATCACGAGCGACTTTGAGTTATCGTCCGCAGGCCAACGACCAACAAGAACGCTCGGTGAAGTCGGAGATGACTT
CCGTTCGTGTATATGCGGAGGATCCTCTTCAACAATACTGGGATGAGATCGCTGAGAGGTTGGTGTTTGCTATTAACACCTCTCAAGGCACAACAAGGAA
AAAGACGCCGTTTTACCTCGTTAATGGCTGGGACGCACAATCCACGATCCGGGCGATG