Description :
From Genome Similarity Track
Location :
Scaffold_841:8502- 11766
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_841-snap-gene-0.7Gene of unknown function

Sequence
3264 bases(100 bases per row)
AGAAACGAGACGCAAGACGCGAGACGAGGAGAGAGGAGAAAGAGAGACGGCCGCGCGATCACGAGACACCACAACACGCAANNNNNNNNNNCCACAGCGA
AAGACCACCAAGACACGAGACACGAGACGCAAGACGCGGGACGAGGAGAGAGGAGAGAGGAGAAAGAGAGAGGGCCGCGCGACCACGAGACACCACAACA
CGCAACACTGAACGCCACTACACACACCACAACAATCACAATCACCGTACGAGTACGACGGTGGCGTCCCCTCGACGACAACGACAAGAGCGAGACGAAG
GAAGAACAGACTTGGTGCGAGTCCACAGCGACGAGGAGCGCCTCTGATCTTCTCGCCAGGAGAAAACTCTGGGCATCTCACCCGCCTTTCGTGCCGTGAG
TCCACAGCGACGAGGAGAGCCTCCGATCTTCTCACCAGGAAAAAACGCCGAGCATCTCGCCCGCCTTTCGCGCCACGAGCCCACACCGCGTCGTCTCTCG
CTCCACTCGACTTACCTTGCCGTCCGCCATATTCACATTCGCCCACCGCCGTACTACTGCCGCCGACGATCCGTCTCTCTCCCTTCACTTCCCGTCCCTT
GCCTTGTCTTCATCTCACACTCTTGCCTTGCGTCTTCCCTGCTTCAGAGCGTTGGTAGCTTCGATCCGCTNNNNNNNNNNGTCCCTTGCCTTCATCTCAC
ACTCTTGTCTTGCGTCTTCCCTGCTTCAGCGCGTTGGTAGCTTCGATCCGCTGGTATACCCGCTCTTTCTTCCAATTTCTCGCGCTCTCTTGGACGGTCG
GTCAGTTGTTGCGGACTCTTCTTCTCTCATGCTCGATTCTGTCCCCGGGCGCGATTCGTCGGTCAGTCACAAGTCGAATGCTGTTCTTGGTGGCTCGCTT
CAGTCTCGATCGTCGTCGCAGCCGATTCGCTACTCCTCGGATGGCGCGGGCTTTCTTCTTCGTGTGCTTGAGCTACCGCCACCGTAGTGGTGCAGCGCCA
CTCGGAGCTCGCCGCTTCATAATGCCGGTGGCAGCTTTCTTTGCCGCTGTCACCGGCATTGGCGTCGGCGTCGGCGTCGGCGTGGTTGTCGCGGCAGACG
CGGTGTCTGCAGATGGGCGAACATCCGCGTTCTTCACGCCGCGCGCAGTCTTCGTCGCTGCCACACGACCTTCTGGTCGGGCTTCTCCCGCCTTCATAGC
TCGGTTCACTTTCGGGGCTGCACGGATCGCCCCTTGAGCTCCAACTTCACGAGACTCGGCTCGTACCGGAACTCGTTCTTTAATACGGTCTTGAATGGGA
ACACGCGGCTTCGTGCGCGGTACGGCTGGAGCTGACGCGGAAACCTTCATCACTGGAGGCGACTCGCGTTGCACTCGTGGTGCAGCACGGCCAACTTCTC
GTGGAGACGTGCCACGTACGACTGGTTTTGCTGTGGTTGTCGATCCTCGTCCCACTGGCTCGATGGCACGCTGAAGCCGAGGTGAAGGCGTTGGGCGAAC
GTTCGTCGTGCGCTTCTTCGGTTCTGTCGCTCGCTGGAGTGGCTTCGCCACAATCGGCGTCCGAGCACTCACTGATCGGCGTGGCTCATTGGTCACGACT
CGACTGGCATCCACGGCCTTTGAAGAGGTCGGGTGCGACGGAGACGGAGTGGTTGTATGTGCTTCTGTAAGCGGAAACGACGGCTCTTGAATGGACTCAT
GCTGCTGTGCTGATGCGTATCCTTGTCCAGCGTTCACGTCTTGGGGCTGCTGATACTGCTGAAGCTTCACTGTNNNNNNNNNNGCATGCTGCTGTACCGA
TGCGTGTCCTTGTCGAGCGTTCATGTCTTGAGGCTGCAGATACTGCTGAAGCTTCACTGTCTGCACGATCTTCTCGGCCTTGTTGGCATCCGCATTCGAT
GCGCCTGCGACCTTCCCTCGCGGATCCACCACCACGGCGCTGTAGTGGTTGCCACTCAATGTCAACACGAGAGGCGCGATGTTGGGCTGGGTCTCACTCG
CCACCAAGTCCTTGAGCAGCAAGCTCGTCCACTCCAAAAACGATCGAGCGTGCGTCTCGTCGACCGCCATGTACATGGTGCCAACGCCACTTGGATCCGT
CGGTGCGTACCGCTGGAAATTCACACGCTTCCCGCTTGATGTCGTCCCAAATGACTCGGTCAACACATGGATCGGACGACCAAGAGCCTTTGCACCTTCG
ATGAGCGTGATGGCACATCCCCATTCGTTCGCCGGAATCGTCGTGCCGAGATCCGATGCATTCGTGGCAATATCGTCAAAATAGCCCTTGATGATCTCGA
GTCGGCTGCTGTCCGAGTCGCCGACTACCATGTCGCTGCGGAGAATCTCTTCCACCAACGACTCCAAAACGGGCGAGTCGGCGTACGTCTTGTCAAAGCA
GAGACGCGCACTGCCACGGATGCCACGCTTGAGTTTCCCCACTGCGCGCTCGAGTTGGTTAAGCAGCTGCACTGCTTTCGGAGAATTGACGGCAGCACGC
TTAAGACGCAAAAGACACTGCTGCGNNNNNNNNNNTCCCACTGCGCGCTCCAGTTGGTTAAGCAGCTGCGCTGCTTTCGGAGAGTTCACGGCAGTACGCT
TGAGACGCAAAAGACACTGCTGCGTGGCCGCCTGCACATACGCGTAGAACTGGCAGTTCCCAGTACCCGGCGTCAGCAGCTCACGCAGACCGCACGCTTC
CAGCACGCCGTCGATCGTGGTCAAGTCGAACGTCGACACATCCACGACGCCGTCGCAAATCGCTTCGACATGGTGCGCAAGGAGTGCCAGCAGACGCACA
CGATCCTTGTGGCACACCGTGTCGTCTTCTAGTGCTTCACGCGCCTCCACGATCTCGAGGATCCAGTCCAACTGGTCCGCACTTGGGGCACACTCGTCTT
CATAATGCTGTTGGGCTTGGTGCTGGTCTCCGATGGCGCATGGAGCTGCGACGCGTTCAGCTTGGCCATTGCTCTCTTGGAGTTGCGCCAACGAGCGGCG
CAACTGCGCCACCTCGCCCTCGCGCTCGGCCAGCGTCTGCTGGAGCTCCTGGTACTTGGTCTGCAAGGCGCCGTATGCGATCTGGAGATCCTCGTACTTG
ACGCGCTCGCGAGCCGTCAACGCCGTGTGTGCGTGGTCGCGAGCAAGCGGCGGCGATGCGTGCTGGACGCCGCGCAGGCCGTGCTTGACCGGCGGCGGCG
GTGGCGCGGCCGCAAAGTCGGGGCGCGTCGCGTGCTTGGGCTGGCTGAACGGGTACTTGTCGGC