Description :
From Genome Similarity Track
Location :
contig_49:85016- 87978
Transcript NameFunction/comments
g9673.t1XP_009524446.1 hypothetical protein PHYSODRAFT_329641 [Phytophthora sojae

Sequence
2962 bases(100 bases per row)
TTGATGGTTTCGGTGCAGTTTCCCGCGCGTTGGGGACGCTTTCGTCCATGCCCGAGACTATTAAGAGTCCACCGACTCGGATCACTACTGCCCCGCACGC
TGTTGCCACGTTTGAACGCGATCCGGTGTACATGCAGGGAAGATATCTGAAGTTCCAGCGTGGACTCAGCCAGACCCCGTGGGTTCTTGACGGCGAGCGA
ATGGGCGAATCCTCCGTGGAAGAGTGCATCGGTGACATCGCCCTGCCATTCTTCAAGGGTGCAGGCTACAAGTTTCACACAGCAGGTCGTGAAGATGTCG
ACGTGCGCATGCTAGGAAACGGAAGGCCTTTCATCTTGGAGATTTTGGGTAAGCTGCAACTTTACGTTTATGTAGCGGTATTAGACTTGGCCTATCTCAA
CCGTATTTGTTTTGCCTGCAGACGCCAAGAAAGCGTACCTGAATCAATCAGAGTACGATGGAATTCAGAAGGCTGTGAATGCCGCAAACAATGGTGCTGT
CGAGATTGTCCAGGTTAAGAGCTCGACGAAGGACTATTTCGCTGGGCTGCAGGCAGGAGCAGACTCAAAGAAGAAAACCTACTGGTGAGTGTTTTACCTT
GGGACAAACTACTACCTCAGGTTAGACTGACAAACTCGCATTTGCTTCCATTATCAGCTGCGTTGTGTGGTCGGAAGGTGAATTGACCCCCGAGTCCGTT
GCGAAGATTGATGCAATTCAAGACCTCACCATTCAGCAGCAAACTCCTATTCGCGTGCTGCATCGCCGAACCCTGATGACGAGGCCGAAAATTATCCATG
CTGCCAAGTGTGAGGTGCTGAACAAGCATTACATGATGTTGCGCCTCACCACATCCGCAGGAACCTACGTTAAAGAGTTCGTGCACGGTGACCGTGGTCG
GACCAACCCCAACGTCGCGTCAATTTTGGTATGTTGTACAGCTGTGCAAGTGCTACTACGCGTAAAGGTTCGCTCACGTTGTCTCCCCTCCTTGCTTTTC
TGCCATAGGACTGTGACGCGGATATAATCCAGCTCGACGTCGAAAGCCTTATTGATGCCCAGTAAACCAACTCGGCGTGGTCTGCTCACCTGGACTCCAG
ATTCTGGAGATCCCAGCGATGATCCAATACATAGGAGATATTTTTGTAGAGCCATCATTGAGTCTGAATCGTTATGCGCATGGTTACTCGTGGATGGGCT
CAGGAAACGCTAACGAGTCGTATTGGGACTCATCCCATAGCTCACCAATCTGGTCTAGCAGCTCTTGGGCTCCCTGTGGAAGGGCTGCTGCTACACTTGG
ATCATCTTGACCTGCCGTTTTTGCTGTAACTGACGCGCGAAGCTCCTTGGCAGCCACCGCTGATGAGGACGTCTGCAGCAAGTTGAGGACTCCTTTCGTG
TTCGTATTCATGCTGCTCTGAGCATCACTCTTCTGCACAACCGTAGCAGCTACTTGTTCTTTGAACTCTTGCAGATTCAGAATATGTTCCTCAAGTGACT
TCTCCATGATTAGTCGGAATACCCGCACGGTTCGCTTTTGTCCAATGCGATGCGCACGATCCATCGCCTGCAGATCAACAAAGGGGTTCCACGAGTGCTC
GATGAAGATCACCGTGTCCGCGCCAGTAAGGGTGAGTCCTAAACCGCCCACTGACGTAGTCAGCAGCAAGACGTCAATTGACGGATCGGCATTGAAGTGC
TGTACAATGTCTGCACGCTTGGCGTGAGGTGTTTGTCCATCGAGGCGTCGATAAGTTACGCCAGGTAATGCGTCCCGCATCATTTCCTCGGTGAGATCGA
GCGTCTTCTGCAGGTGGGCAAACACCAGGCATCGATGAGGAGAAAAATTGCTATCGTCATCACCTTCAGTTGCAGGTCCTTGGCGACCTTCCTGAGTCCA
TGCTGCAATATCGCAGCACTCAACCAATAGATCGCGCAATCCAGTCATCTTTCCTGAGCTTTTCCAGTCAAGCAGGGCCCCCGTTTCCTTCGTATTAAGC
CCCAAAGAGATTGCGTTGTCAGCAACGAGCGCTGGATGTACACAAATCTTGCGCAGTAATTGAAGATTTGTTAGCACGTTCGTCAATGGTTTCGGCTCGG
CCACCTTCGTAGACCGAGAAGATGCCACAGAGCTTGTGGGATCGCTCTCAGATGACGACGCCAGCGAGTACAAACGTTTCTGCAGCGAAGTTAACGGCAG
TAGCACGTTCGAGATGATTTTCGGTGGAAGCTCTTCCAGCACCTGGTCTTTCGTTCGTCGCAGTATAAATGGCAGAACCTTTTGGTGCAGTTTTGTGATG
GCAATCGCTGCGAGCTCCTTTTGCTTTGACGTTGCATTGCGCTCTTTTGACTTTGTGATTGGAAGGACAAACTCGCGACGGAATAAAGTAAAGTCGCCTA
AGTATCCAGGCATTAGGAACTCGAACAGAGCCCACAGGTCTGTGACGTTATTCTGCAGCGGCGTTCCACTCAAGGCCACACGATGTGATGCGTGAAGGTT
CGATACAGCACGGAATAACGCTGTCGATGGATTCCGAATCAAATGTGCTTCGTCCAACACCACAAAAGAGTAGTCAATATCTCCCAAGCGGTTGATGTCT
GTCCGCAGGATCGAGTATGTAGTCACGATCAAAGTCGTGCCGTGATCAGATATCACGATATTTTTGCCGTGACCCAAAACTTTTCGGTCACTTGCTGGGA
CTGAGTAGTCGATGACAGATGCGAAGTATCCTGGAATGTATTTCTTGGCTTCTTGGATCCAGTGATGCACGATAATCGGTGGGCATACAACGAGACAAGG
CCTCGCTGGACGTTTGCTTTGGGCTGTAGATGTCATTGCTAGTGTTGCAGCCATGGCAGAAAGCGTTTGGAGTGTCTTTCCGAGGCCCATATCATCGGCG
AGGATCCCATGAAGATTGTTCCTGGCCATGAAGCATAGCCAGTCTACGCCATGCTGCTGGTA