Description :
From Genome Similarity Track
Location :
Scaffold_117:85004- 91908
Transcript NameFunction/comments
Physo_142566hypothetical protein
Physo_158570hypothetical protein
Physo_142568hypothetical protein

Sequence
6904 bases(100 bases per row)
TGGTCATTTCTACTCGGTTGTTTCAGAGACAGCAGCATCAGTGTCGAATGGTGCTGTCTCCAATACGCCAGCGTTTACATCCACTTCGACTTTTGCACCA
GTCTCGTCAGCTGGTGGAGGGGCCAGCAAGCCGGCCTCGCGCATGATTTCGCCAAAAGATTCAATTTCCTTGCTCACAGCGTTGGCTGCGCCAAGAGCAG
CCGCCGATGGAACCGGGAACAAGCGATGGAAGCACTTGATTAGGTACGGCACAAGCTCCGAACGAATTACCTGCAAGCATAACACAATAACGTTAGTGAT
AGGAGACGGTGGCATACAAACACCAGCAATCCCATCACCTCATTCATTGCTCGAACCGATTCGGTAAGTGTCGCTGCCCTTGCATTCCTCGAGACACTTT
CACTGCCTTCTTCGGTCGGAGCGTGCAGATCCAGCCCGTTCTCCTGGACGAAGTCGGCGATCGTAAGCAGCATGGTGCCGATTGCGCTCTGATACTTTTT
ACCAAGACGATTCTGCAGTGACGAGATTGCGCACAGTCTCAACTCGTTGAGGGACGATAGCAGCGCGTTCGTGAACTCTGCCAGCAATGGGAACGACATC
AGACACCGCGGCGGTGAGTAATCTTCCCCGTCGGATGATGTAGCAGTCGGGCGAGAACCGAACGGGAAACTGTTGCCACTTCCATTCGCCGACGAGCGGT
ACGACGCGATCACGATGGGAGTCTTCGAGGAGGCCGAAAAGGACGACCCACTGGACGCCGACAGCGAATGAGCGCTCAGGTTTTCTTGGAACTCGCGGCA
AGCCGCTCGCCAGTACTCAGTCATCAAGTTTAGTACGTGGTCCTCGAAGTATACCACAAGGACAGCTCGGAAGTCCACACCAACACGACCTAGCGACCCT
CCGAAGAACAGACTCTGTTCGAGGATTGTAGCGATCGAGCTGAAGTCATCAATCTTGGGGAGTTGCCTGGCCACAGCAAAGTAGGTTAAGGTTAGTTAGA
CGTCCAGCGCAGGCTGCAACTATGACTGCAAGAAAAAATCAAACTATCAACGTACTTCATGAGAATGTGGATAAAGTTTGCAACCGTCGATGTTGCCCAG
CGACACAGCGGAGGATCCACCTTACCATCTACGTTCTGCAATAGCACCAGTTATCACAACAACAAACACTGTTAGGCCCTCATTATTGCATAACAGCATA
CTTCACCCAATGCAAGTTACCTCGCTGCCGAAGATCGCCGAGTATTGAGTAATCATATCAAACCAGCTCGTTCGCTTGATGTCGATCACTTGAATAATCT
ACAGCACCACCAACTCGTCAGAAAACCCGATCAAACACCACCCACACTCTCCCAAAAAATCAGGCACGCACATATTGGTACGGGTCGGAGGACGGAATGC
CTCTGCTCAAGGACGAGAGCCACACGTTCCTGCAGGCGAGGAACTCCTCCTTCAGTTGCTTCTCGTACTCCAGCGACCCCACCGCCGCCGCCGCGTCCTT
CTCCACCAGCGCGTCCAGTCGACGCAGATACCCCACAATGCGCACGCACAGCGCGAGCTGCAGGTCCTCGCGCAGCTTCTGCAGCAGCTTGTCCCTCATG
ATGCTGGTCATCTCGGCCACTTCGCGCACGAGGCAGTCGATCACGAGGTTGCGTGACGCCTCCGCGTCAGGGTCAGCTCCATTGCCTTCACCTTCTCCAG
CCTGGAACGTCTCGTTGGCGAACTGGATCACGTCCAGCGCCGAGTCGAAGAGCTCGTTGTGGATGCAGGCCTCGAGCAGCTGCGGGATCTCCAGCAGCTC
CGTTAGCTGCAGGTAGTGCTCGAAGACGAACTGGATGTCGCCGTGCTTGGCCACGACGTCCGCCACGTCCCGCTGGAAGGTGGCGCAGTGGCGCTGCAGC
TCCGGGATGGCCGTCTCGACCTCGGTCGTGTCGCTCTGGAGCTCGGCCAGGTCGTCCTTGACGATGGCCGCGCACTGGTTGCTCTGGATGAAGACGTGGT
AGTTCTTGAGCACGAGGTCGCGCAGCTGCTCCGCCGTGTTGTCCGCCTGGATCTGCAGCCGCCACGGCTCCTTCCTGAGCTCCTCGAGCGAGCACGTCTT
GAGCGACGCCAGCGTGGTCATGATCCCCGATTGGGAAGTTGGAATCGGAAATTGTCCGAGTTGGATTTGCAATATTCGCGTTAGTAATTGCAATATTTGG
GTTTAAATATTGTCGACCGGCGAAGTGCCGCGGCCCGCGGGAGACGTTTGTCTGGCGTGGCGTAGAGCCATTCTGTATGGGAGGTGGGGCACAGGTAAGT
GCACGCACTGACGTGCTCGTAGCTGGAGCTGTCAACCGCTCTTCCCTTGCTAACCCAGCCGGTTCCACGTGAAGTCTAACCCCGTCGTCTCGCTGCAAGT
CAGCACAGACGATCGGGGGACAAAGAGGACCTACCGGTACTGTTCACTCATGGACCATGAACCTTGGTTAACACGGTGGTTGGCCTTCAGGAGGCGCGGT
CCCAAATGACTCAGACTTGACCAAAGGCGGAGGACAACTGTACGGGCCTCGATTCGTCGATCCTACAGTGTAATACATGTGCGCGTACGATCACTCTTAT
AAACGGCTTCAGGCTGTATAAGTTATAATACATGTACCTGATGCCGGGCTCGGTGTTGGTTCCGACGTGAATTTGACGCCACCTTCCTCGCGGCTAAGGC
ATCCTCGGGCCGAAAAATTATTTTAGTAAAACAGTGGACGCACAGAAGTCGGTACAGCATCCATAGCGCTGCAGGGAGCAGGTTGACCCAAGCAAACCAC
AGCCCAGCAGCGCTCTCCTCTGTATGTCAACGTCATCGTCTAATAGGGGGGGATGGATCCAAGATCTTCCTGCAGGCTGAAGCAGGTTGAAGTGCGACGG
TTTCAGGCTGAAGTTCAACTTTTGGCCCTAGCCCTCGTTTTACTTGCGACATACTGAAGCCCACATGTGCCAGTTCAGCAGCCTTATCTGACGATCGCGA
CTCGAAACGCAACGACCTCCTTCCTCCGCGGCGGGCAGGAACGAGCATGTGGCCGCGCCTTCGTCACGATTGCAGTGCAATGCGCTCCCTCGAGGTCATT
TCCTGATCGTCCCATAGTCGAATTCGCCTCGAAAGTCGCACAAGTCTCCACCTTCGCCCCCTCCATCTCCCTCTGCACCATGTTGACGCGCAACATTCCT
CTGGCCTCGCGCTCCGCAGCGCGCATCAGCCGCCGTCACTTTGCCGCTGCCTCGCCTTCGGCCAGCGCCAAGCGCGTGAAGGTCAACGGCCACGGACACG
AGGCGCAGCAGAGCGGCCAGCTCAGCTACGTGCCCTCGGGCTCCGACGGACGCTTCTACATCGAGCAGCTGTACGTTGAGTTGTCTGCCTGCTCAGTGCC
ACGAAATCCTATCTAACACTAAACTCGGACGTTGCATTGGATTCATGTAGGAACGAGCACTGGCGCTCGGCGGTGGCAGGTCAGAACTTCAAGAAGGACG
ACGTGATCGGCTCGGCCCCCGGCAACTTGGTACGTCGATTGTACGCTTGGGTTAGACCGCGAGATGCGCATGATAACTCACTTTTTACCTGCCTGATGCC
GTTCAGTACTCGAAGCCGACGCGGTTCACGGTCCAGATCACGCCCGACAAGCACATGGACTTCACGGGCGGACTCGAGTTTGTCAACCACAGCTGCAACC
CCAACACGCGCATCGACATGTCCGAGAGCGAGGCGATGGTGTCGTTCGTGGCGATCAAGCCCATTGAGAAGGGCGAACACTTGACGTTCGACTACTCGAC
GAGCGAGTGGGACATGGACGAGAAGTTCGACTGCGGGTGCGGTGCGCCCAACTGCCGCGGACACATTGGCGGCGCCAAGTACCTCAACGACGACGAAGTG
AACGCGAGACTGCCCTACTTCACTCCCAGCGTGCTGCGTCAGCTGCTCGACCGCAAGCTCACCAACTAATTTTTAACCGAAAGAGGCAAGGAAGCCTGCA
CTCCGAGCTGCCGTAGCGTTTCTCATTGATGTTCCCAGGCTACTCCCAAGTGCCTTAAAATTGTAGCAGTTGGAAGGGACCATAGGAAGCGGAAGACCGA
CAAAATACACAAACAAAACTGTTTACACAAGTCTGTTATTGAGTGTTTTTGGATCGCGTAGTGCTCGGCGGATACGCGTCAGGCTTCGAGGCAAGCGATT
GCTTCCACTGCTCGAGCGTCTCGATCACGCTGGTGGTCACCTGCTTGTCCTCCATACGCACCCGAACTGCGAATGCCAATCGTGGCTTCGATTCGGTCTC
CGTTTCTGCCAGAATCGCCTCGTCCTCTTCAAGTCTGTTGTGGCAGCATACACGATCAAGCAGATGCGTCAATTTTATGGGGAAAATCGGACAAGACTGA
AAGCATGAAATGAGAATCAACGTACGTTGTAGCGTAGTTCGAGAGCTTGCGACGACACGTGCTCTGCAGATTTTCGTACACTGCCAGCTCATTACGAACG
CTAAGAATTGAAGACTCGAAAGCCTGGAACGGTAGTAAAAGAGAGAGAAACGGTTAGTTACCGGAGCTGCACATGAAAGCAATAGGCGACTGAGGCTTAC
CTTCTTGTACTGACGGATTTCCTGTTCGTTCATCAGGATAACGCGCAGCGTAGCCAGCAGCCTTTCATCAACATCATTGCTAAGCAGCGTTCCGTGGAAG
TCGTATGTCTGCTCCTTCGTGAGCTCGTTCGAGTCGAGGACAGTCTGCTTCAGCTTGAAATACGGATCGGACAGCGGGATCTTCATCCAGAAGTCCACAC
CACGACGGAAGTTTTCGGGCGAGACGAACCCGTACGAATACAGCAGCTTCGCATTCGAGTACTGGCCGTAGCTGATGTGCACGGCGGAGCCAGCGGCCAC
GTCTTCCGGGACATGGTGCGTCATCATCTGCTTCTCCTCGTTGAACGAAACGAAGTCATCCAGCGGCTTGCGCACAGTCACGTCGTGGTTGAACATGTCC
ATCGCTGGACACAGCACGTGAAGGTACTTGCCGCCCTTGCTCACGCCGAACGCGCGGCTCCAGATCACGCTCATGGCCCACATGTAATCGTCGATCGTCA
ACGTCGGCAGGGACGCGAAAATGTCGGGGAAATCCGCCGCCACGGCCTGGTGGATGTTCTCGAAGTCCCTCTCCAGGTGCTGCTTCATCAGCTGCGTCAG
CAGCAGCACGTTGGTGCCCTTGAGCTCGTTGAGCTCCGCCTCCGTCCAGAAGACGGGCAAGTCGAACGTCGTGGGCATCGACGCGATGAACGGCGCAAAG
AACGACTCGCCCCCTTTGCTGCGCTCGTGCATCAAATGCAGCGCCAGCACCTCGTCGTCCGGGATCTGCGGGTACTTCTCGAGCACGGGCGCCAAGTCCG
ACGTGGCGGCGGACTCGGTGTTCATGGTGAGCTTGAACGGCACCTGCAGCGTCACTTGGCCGCTGGTCAGCGCGCGCTTGGCGAACACGCCGTGACCTTC
GAGCTTGCCCAAGTACCGGATGTCCAGCAAACTGTCGGCTGCTCCATGGGCCTCGAGCCACTCCAGCAGCCTCGTCACTACAGCAGGAGAGCTCATGGGG
TCTAACAGAGCTCTTCGACTCGGACTTGGCTACACTTGTGACAACGGATGGCTGATGTAGATATGTGTTTTTACAGTTATGAACAAATCTATAAAGTCTG
GGGGTATCTGTACCCATTTCGGTGGACGCACGTCAAAAAAGGCAACTGTAACTTCAAGGCAGACCGGCGTCGTGCAGCAGGTCGCTGAGTATCAAGCCCG
TGAGTCTCTGCTGCAGCTCTTGGTCTTGCTGGGTCTGTAAGGAAGAGAGGATAGAGGTGCTTCTGGCACGGGAGACTGGTGTGCGCGAGAATATTCCCGA
CCGAGAGGGTTGAGCTGCAGTAGACAGGTCCTCGGTGGTTCTGCTCAGATCCGATTGCACCTTGGAGACGATGCTGCTCACGTTAGACGCGATGCAGTTC
TGCGATAGCAACACGTCGCTGTTGAGGCCTTCAGCGCCAGTCTCATCGGAAAGCAGCTGCACTTGTCGCTCCAGTTCACGCTCGGACTGCTCTCGGATCG
CTAGGAGCTCCCTGACTTCGGTTTCGACGTGCTGCTGAATGACTTGGAGCACTGACGTCTGGTCCAGCGGGACCTCACCGGTTGCAGTCTGCTGGATCGC
ATTGAAACAGTCCTGGGCAAGCGTCTCGACAGTGTCATAGAGTACACGGGCAGCGGGCGAAGCTGACGCCTTTGTGATCTCTTGCAATGCTGGAAGACGG
AGCTATTCAGAAGAGTAACATCCACAAAAAATTAGTTAAAAACGACAACAGAATACCAATCGAAAGCACGTAAGCATACCTCGCCATTCACAATCTCGAG
TCGCTCCACCAATTGTTGCGTTGCATTGAGATCCCTCCCTTTCGACGCCTCATCGGCTACTCGCTTCTTAGTTTTTGGGGAGTTTCCAACTCTTGCAGTG
GTGGTGGTTGTGGATGCATTGGTGCTTGTAACTGAGCGTTGTGGGCTTCTTTGGGATGACGCTGCCAGTCTACGGCGTGACCAAATCCGCAACTCCGAGT
TGATGGTATCGTCGAAAATGCTAGCAAAGATTTCGTCCGTCATTCGTTCACTTTCTGCTGCGCTGTCGAGCTCGTTGTCCCCTCCAGGTGTTGCTTCGGG
TGATGCACTTGGCAATTCTTCAGCTATTGGCAAAATGGTCTGTTCATCAGCCTCAGCGTCTTCATATAAAATTGTCACTTCGTCGTCAGGTTCAGTCTTA
CGCGGTACAGCAATGGACACCATGGGCTCATCAACATCGCAATCAGCTGGTTCTGCGTCCTCGACATAGTTGTACTCTTCAAGTAAATCGATAGGGACCT
GTTC