Description :
From Genome Similarity Track
Location :
Scaffold_21:85002- 88278
Sequence
3276 bases(100 bases per row)
TCATGTCTATCGACGTGTGCCGCCCCGCCATCTCGGCAAGCTGTGCGAGTTGTTAAGCATCTTTCTTAGAGCCGTGCTCATCGTTTTCTCGGACAGTCCA
TGGCGTCGCCGATCGTGATTGTTATGAAAAAGAATGGTCTCGACATACGACTCTGCATCGATTACAAGATGGTGTCATCACCGCAATCATGGAGTTTGCG
ATGCCGTTAGTGGACGACCTGTTGACAGATCTCGAGAGCTACCCATGGTTCTGCTCACTGGATACTGCCAGCGGCTTTTGGGTCATCATGATGGTACTAC
GAGCGCGTTAAGTGTCTGCATTCGTTTGTGCACTAGGGCACTTCGAATGGCTGCGGATGCCTTTCGGGTTGAAGAACACTTCTGTGATATACCAGCGCAT
GATCGGCAATGCGTTGTGGGCGTTCGTCCAGCCTAAAGGAGGATGACGTAAATATTCGGAGCTGATGAGTGCAGCTGAAGAAAAGGCCAAGGAACGTCGA
GCGACCAGCACCGATGGTTTGTTTCAAACCAAGCTCAAGGTAGATCGCAAAGTATCAGTAGACACTGCCCCAGTAATACAACTGGTCAATGACCCTATCG
CCGATATGTTTCAGAATGGGGAACCCGACAAATCAACGTTGGTGCTAGTATTCGGTCGTCGGTCGCTTGTCGATGATATCTGCTTCGATGGCGAGGATTT
CGATGGCTCTAGCGACACTAGACCGACTGCTTGCTCGATTTACAGAATGTCGGATAAGTGCCAGTTCTACCAAGAGCATCTTCTACCAAACAAAGGTAGA
CTTCCTGTCACATGAGGTCTCGCCAGAAGGAATAAGGGCTGACCCGAAGAAGATTGCAGCCATCACCGAGCTGTCGTTCCCAACGACCAAGCGAGGGATG
CAGTCATTCCTTGGGGCATTGAACTACTATAGCCGATTCATCCAAGATTTCGCGGTCTATGGTGCAGCATTGTACCAACTGAAGGAGGAAGACTTTGGGC
TGAGCGGCGGTCTCTCAGTCCCGAGCATTCGCGACACTACAAGCGAAGGTGGCCGAGGCTCCAATCTTGAAGCACTTCGACCGAGTTGATGTGATGCTTT
TCGCCAATGAATGGGCGTTGAGTACAACACTTATGCAAGAGCATGAAGACAAGCTACACACCGTACGATTCCTCGGTTGAGTGCTCAAGGACTCTTAGAT
GAACTACCACCCAGCGGAGAAGGAGGTACTGGCGCTCCTTTTGTCCCTGAAGACGCGTTACACGCAGCTTGCTGCGAAAAAGTTACACGTGTATACAAGG
TTTTCGACACTAGCCTGGGTCCACAAGTCCAAGTCATTGTTCGGTCGCGCCGTACAATTTGCAGTACTGCTGTCACCGTGGCACCTGATCGTAGAACGAG
TCAAAGAAAAGGATGTGGCCTTTGCTCAGCTACTCCAATCCACTATCACAAACTTCGTGGATTTGGAAGAAACGTTGGCGCCGTTGGCTCCTCCAAGCAA
AGGCTCACCGTCGATTCGCGTGGACTCATCTTTGCTCTACGCGAAGCTACCACGCGACTACCGAGAATTTGCCTTATCGTTCGATGGATTTGCAAAGACA
GAGAAATATGGTGGTTATGGCAATTGTTCGTGGATATCACGGAGTCTACCGGAGTGGAAAATAGTGATCGCTGCGAATGCTTACTTCCCGTCTACTACGG
TAAACCTAGTCACTGTAGGTGACTCGAGACTCGCGATCCAGCAATCACTAGGGGTGATAGCATGTCGGAAGGAGTCCCTGATGGCACTACCGAATACTCA
CAAATAACTCGCGGTGAAGCTACGATCAGTCAAATACCTTCAAGTTGTGCTAGAATACAACGCTGCCGCAGATTCGCTAGCCACCGAGGCTTTGGAGTCG
AAAGCTAGTCGAGTCATATTAGCCGAAACGCAAAAATCGGGGTTAGTGACGTTGAACCGCATTCAAGAAGTGATCTACGAACTAAATGAAGACTCAGCAG
AAGTTGGGCCACATCAGAAAAAACGCTGTGTACATGTGCTAACCGGCAACGCACGTTCTCCACGCAAGACTTTCGAGAAATTCGTGAGTGACGACAATTC
GAGCAAATTGAACATATTACAGTAAAGACCAGACGACAAGCCAAAGCTAAACGTGTTCGATTCGCCGATGAACATTCGGAGCAAGCACCTAAAGGTCAAG
AACAGGGTAAAGAACGTGATGGAGTGGTCAACGAGCATTCTCCCGATGACATTTCACGGGATCAACCCTCCAGCACTAAGCGGACGTCAGTACCTGGTGC
AGACGATGTCGACCCAGTAGAGATACAACGAGAGCGACGCCGACAAATTTCCAAGGCGCAAGACGAAGAACAGAAGTGACCAAACCTGAAGAAAGTGCTT
TGAGGAGAGGCAGAGCGGATGAGCTACAAGGAAGCTTGAAACGCATGGAAATACGCAGACCGATTCGTTCAGTCAGAAGATGGTGTGCTTCACTACCTGG
GTTTGAACCAAGGATGCGACCACGGGTGGCAAGAGGAGGCCAAGCTGCGTCTAGTGGTACCTACCACGATGGTTCAAGAAGTATTACAGAAATGCTACGA
CTCGTTGGGAGGTGGTCATCAAGGCGTCGCCAGGACCTTCCACCGTGTTGAGTCCGACTATTTCTGGTTTGGGTTGTATGCTGACGTGGAGAAACATGTG
AAGTCGTGCCTGGATTGCAGCTCACATAAGAGTCGTCCACAGTTGCGAGGATACTCGCCAGGCAATGTACTGGCCGAACAACCGTTCCAGATTGTCTCTA
TGGATTTTGTGATACCTCTACCAAAGACACGCAGGGGCAACACTACCCTGTTGCTATTCCAATGCTCGTTCACTGGGTTCGTTATTGCTAAGGCCATGTC
CGACACATCTGCACTCAGCGTAGCGCGAGTGTTCGAAGAGTGTGTGTACCGACGGTTCGGAGCACCATCGTTGATTCGGCATGATCGAGACCCCAGGTTC
ATGAGTGAAGTTTTCCGAGCCTTCGCCGAGATGATGCAGCCACGATCACGAGCGACTTTGAGTTATCGTCCGCAGGCCAACGACCAACAAGAACGCTCGG
TGAAGTCGGAGATGACTTCCGTTCGTGTATATGCGGAGGATCCTCTTCAACAATACTGGGATGAGATCGCTGAGAGGTTGGTGTTTGCTATTAACACCTC
TCAAGGCACAACAAGGAAAAAGACGCCGTTTTACCTCGTTAATGGCTGGGACGCACAATCCACGATCCGGGCGATG