Description :
From Genome Similarity Track
Location :
Scaffold_2907:850- 2394
Sequence
1544 bases(100 bases per row)
TTCACTCATGAATCGTGGGTATCGATAGTGCCGGATCAGCGATGGCGCTCCAAACCGCCGGAAGACACATTCCTCGAACGCTTTAGCTACTTCCAGTGCT
CCAGTGTCGCTCATCGCCTTAGCGATCACATATCCAGTGAAGTGGTCTTGAAAGAGAAGCAAAGCTGTGTTACCTCGCTGAGCTCTTGGAAGCGGAATAA
CAAAGTCCATTGACACCATCTGAAACGGTCAGTCGGACATCACATTTCCTGGCGAAAAACATCGCAGTTGGGGGTTGCTTTTGCTCGTGCTACAGTCTTC
GCACCTCTGGACATGCTTGACTACATCAACGTACAAGCCAACCCAGTAGAATTCGGCTTTCACCCTATGGAAGGACCGTACAATGCCTTGGTGTCCGCCC
TCGATCGAATTGTGGCAGCTCTGGAGTACTTCGTCGATCATGGTGGTCGGAACTACTAGTCTTAACGTCAGGTCATCACCATTGGACTCAGCTCGGTTTC
TTCGTTGTCCCAAGTAGTACAAGAGTCCGTCCTCGCTGAGTACGAAGTTATCGGCAATTTTGCTTGCATTCTGTGTCCGTCGGTGTGTAAGACCGTCGAG
TTCGCCTTGGAGTACTGCTTTCACGTCTGCCCACTTTGCTTCTTCCGACTGAGCTCTAGATATACGTCTTCGTCTTTCAGCCTGGACGACCACTGGGTCT
ATGTCAGCTGAGTTGGACAGTCGATTCTCGTCCACTTCTATCTGAGCTTGTCCTTCCACTCGGCGCATTGGTAGATTCCGTCTCATTGACTCACAAGAGC
TGGTTTCCGATGTTGGACTCGGCTCTGGACCCTGAGATCCTTGAGCTGAGTCATGTGGCATTTCATCCTCAAAGTGGACTCGGCGGGTTTGATTCCTCGT
CATGACTGCCATCTCAGCTGAGTCTTTATAGTGGTCCGCTGAGTTCTTTTCCACATATAGGACTTCTGCGATCCTGTTTAGAGTTTTGAGCTCAGCTTTG
CGGGCTTCGTTGAGAACTACCCGGCCAGCTTTATTCTCCAATGCTTCAGTAGCGAGGGAGTCGGCTGCCGCATTATAGTATCGCACTACATGCAGGTAGT
GAATTGAACTCAGCTTTCCAGTCAGGTCTTTATGGCGCGCAAATTCAACTTGCAACGATTCCTTCTTAGATGCGATCACCCCCATGGATTGCTGGATTGC
AAGCCTGGAGTCACCAACAATTATTAAGTCAGTCACCCCACGGGTGATGGCGACCTGGACGCCGTTATTCATACCGGCGTACTCGGCTGTGTTGACTGTG
GTCGACGAAAGGTGCGCACTCGCAGCGATCTCAATGTTCCAACTTGGCAAGCTCCACAGTATCCACGAACAGCTTCCGTAACCTCCATACTTCTCAGTTT
TAGCAGATCCATCAAAAGACAGCAAATATCCTTCGAAGTCGCGCTGGACATGAACATACAGGAGTTCGGGGTTGAACCGGACCGTCACcgagttcttcga
cggcggAGCGATATGCGCTAACGACGCTTCGAATCCAATACAAT