Description :
From Genome Similarity Track
Location :
Scaffold_547:850- 2308
Sequence
1458 bases(100 bases per row)
CTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGCGGTCTTCCACCTCGTTCCAGGTCATGTTCTCATTCGTCTTGACCCAGTGGTAACCC
CACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGA
CTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCACCGATAAGGCCACGAGGAGCCGAGAG
CTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTG
GCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCAC
CCTCCTCGTCCTCAGACCCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTT
CGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGTCAGCGTCAGATGCTTGGGTGGCGACACCGCCTTGGGCTCAGAGCCCGTGTCG
CTCGACGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGAGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGTCTCCT
TCTCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTC
GTCGTCGGGTGAACTCTCACCGTAGTACTGGACCATCGTGCAGTCAACGACGGCGGCTTCCCAGTCACGAGCCGGGCTTTTATGGCCCCGAGGACTCTCC
TCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTGCGAGAGCGCACCACCTCCTCGGCCGCCT
TCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGC
ACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGA
GCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGG
AGGATGTAACGGGGTTACATGGAATAGTGACTCTGTCACTATTCCGGGATGGCTACAT