Description :
From Genome Similarity Track
Location :
Scaffold_424:85- 5613
Transcript NameFunction/comments
Phymu_g9762hypothetical protein PHYSODRAFT_553661
Phymu_g9763hypothetical protein PHYSODRAFT_320741
Phymu_g9764hypothetical protein PHYSODRAFT_320742

Sequence
5528 bases(100 bases per row)
AgcgatgaaggtggtggcgctcGTGAGTGGCGGCAAGGACAGCTGCTACGCTATGATGGAATGCGTGCGCTTTGGCCACGAAATTGTGTGCCTAGCGCAC
CTGCACCCGCCGTCGGAGCTGTCTGCGGACGACGCGGAGATCGACTCTTTCATGTTccagagtgttggtcacCAGACTGTAGGGCTCATTGCCGAGAGTA
TGGAACTGCCGTTAGTCTCCGAGACCATCACGGGCACTGcagtgaagacggagatcgaCTACCACGAgtctgcagctggagacgaggtggaggatCTGTT
CCGcttgctggagaaggtcaagcagcagttcccgGACGTGCAGGGCGTCTGCACTGGCGCTATTTTCTCCAGTTACCAGCGCAACAGAGTGGAAAATGTG
TACGTCAAGTGAGAAGCTGCATGTGAAGTGTAGAAAGCTGATGTTTAACGCTTGAACAGGTGCTCAAGGCTGGGGCTGACGTCGCTTGGATACTTGTGGA
GACGGGAGCAGACtgaactgctgcaggagatgaTTGAGTCGGAAATGGAGGCCATATTGGTCAAAGTTGCATCTATTGGCCTGCAACCAAGGAGGCACCT
AGGCAAGACCattgcagagctgcagccacaattCATGATGCTGGTAAACTTTCGGACCATGATTTGGTTTACGAGCCTACCGTTTGCTTATTTTTATGGT
GTGATGTCCGTGCAGAAGGAAAAGTACCAGATGAATGTCTGCGGTGAAGGTGGGGAGTACGAGACCTTCACATTGGATTGCCCGTTGTTTAAAAAACGCA
TTGTCATGTAAGTTTGTTTGGCGCCGGGATGTAATTTTTTGATATTCAAGAATCTCACAAATATTATGCGTTTCGTCTGTCTTAAAGTGATGAGAGTCAC
ACGGTACTTCATTCGGATGACTACATTGCGCCTGTGGCTTTCCTGTCGATCGACAAGTGCCATCTTGAAGACAAAGACCCTGCTGATCCGTCGCACTTGG
CATCAAGAGTTCCTGGAGATTCTTCTACCGAGCCAGAAACCAACGAAACCCCTACCGACAAGAAGCTAGCCGTCGTGCTCGCTCTTACCCCACCGACGGC
TAAGGATTTCGTGCCTACATTCGGTCTGTTCCGCGACCAATTACACCTTTCAGGAATCATGAGCAGCAAGGCTGGTGACAACTCAATCACattggaagaa
gaagtggtgGATGTTGTTGCTCAGCTGGAGGCTATCCTTAAGAGCCAACAAATGGTGCTAGCCGATGTGTGCTTCGTGCACCTGTACGTTCAGGACATGT
CCGCTTTTGGGCAGGTAAACGCGGAGTATATCCGGTACCTCGGCCAAAACCTGCCCCCGTCTCGTAGTTGTGTCGAACTAAAGGCATTGACGGATGTCCC
CGCCCGTGTGCTTTTGGACTGTTTCGCCTTGCGTGGCAGTGGCGAACAAAAGTTGCAGTCTCTTCGCGTGCGCCGCGATGTTCTGCACGTGAAGAGCATT
TCGGCTTGGGCACCGTGCTGCATTGGTCCGTACAGCCAAGCGAATGTGCTCCACCGAGCGCTCATCCTGTTGGCCGGACAAATCGCTCTCCACCCTCAAA
CTATGGATCTGGTGCCAGGTGATCATGCTGCACAGACGACACAATGCTTTCGCAATGTCTGTCGTGTTCTagaagcgctgcagtcgaatcTGCGTCATGT
TTGCTCTGGTATTATCTACACCACCGGGGACCCTGACGACCGTGAGGCTCGGGAACGCCTGCTAGTCGAGTGTCGTCGCCACCTCATCACCAACGCCGAA
ATGGCCGATGAGTTCGAGGATGCTGACGATAGTGAtgagagcgacgaagaagtcgacaAGAACGAAGTGCGCCTGgagttcgtcaagaaggcgccgCTGT
TGGTCGTCCAGCTGGCTCATTTGCCGCGCAATGCACtggtggaagtggagctACAGGCACTCACACACATCGCGCTGAAGTATCTGGTACCGGGCTCTTT
TTCGTGTTCAAGCTTAGCAGACGGTCTTCGCTTCGACTGGCAGAGCGGTATGGTTCTGCGAGCGCTTTGCCAGATCATGTGTACCGCTTCAGTTGAAAAC
GATGAAAGCTATCAAGATACACGTTCACTAGCAAAGGCTGCCGCTAAAGGGCTATGGACCTGTGTGCTGGACAGCCTGGTGCAAGCTCTGATGCCTTGGG
ACCGCGTAATTCATGTGCGCACGTTCTACGTGGCAACTGCTTTTTCTAGTGAGGTGGAGCTAGCCAAGGCGTACCACGAGACTGTTACAGCTCGAGGCAA
GGCCAACAGCATGCCAGGTATGACGTTTGTACCTGTCGACGCCATTCAGAGCGACGCTGTGATTGCACTCCAGGTAACGGCACAGGAcctggacaagctg
gagacTGAACTCTGGCTGCACAAGCAAATCTAGACTACATGTTGAGATTGATAACGATTGCCAGTTTTGTAGATAACTGTGAGTTACTGCTACGATAAAG
AAGACTCACCGAGGTATAGTGCAATTCCTTATTTTTTTGTCAGGTGCTTGATCTGTCTGTACTCAGCAGAATGGTCTTTTAGCTGTCTGCTTCACTGCTT
TTTGTTTTCTAATGTCGCCGCTTGTGACGCTGGTCGCCAGGGCCTCGGCTACCGCTAGAGCTTTCATCCCGACCCTTGCGCTTGCGAGAATCACGGTCTC
GAGAACGCGAGCGCCCACCTCGGTCACCTCGGCTGCGCCCACCTCGCTCTCTCTCCTGGCCTCCTGGTCGACCATCGCGCTCTCGAGGACGTTCACGATC
GCGACCTCGATCCCGTTCTCGGCCACTGTCTCGACCTCGATCCTTCTCACTAGCATCTTTGCCGCCAGCATCTCGACGCCCACTACCTCGTGATTCATCA
CGCCGAGAACGCTCACGAGATCTTGACCGGTTGCGAATCTCCTCTCTTGATCGACCAGCCCGTTTGTCGTCTCGGTCGCGGCCTCGATCCTTCTCGCTTG
CATCTTTACCACCTGGGCCATCTCGACGGCCACTTCCGCGGGGTTCATCACGGCGAGGACGGTCGCGAGACCGTGATCGGTCACGACTTGCTTCTCGTGG
CCTACCACTGCGTCTATCATCGCCGCGGTCATCCTTACTACGGCCCCGGTCATCAAAGCCCCCTCGGTCTCCTCGACCCCTGCCACCACCAGGCCCACCC
ATCCACGgagctcctcttcctggacCCGATCCCCACGGTGCGCCGCCCATAGGCGGACCATTCCAGTTCTGCTGACCCATGAAGCCCGGTGGTGGGCCCA
TTCCAGGGTGCCAGCCTCGAGGAGGTGGGCCTCCCATGAAACCACCTCGAGGTGGTGCGCCACCCATCGGCGGCATCCCATTACCCCACTCACCATTTTG
ATCGTCACTTTCCGGCTTCATCTGCCCGGGTAATCCACGCGGGGGCattccacctcctcctcttccttgcaTCTTGGCATCTCGTTCTCTCATCGCTTGT
TGGTTAGCTGCATTCACAGCCTGTCTGGACGCCTGCTCTCTTgacttctccactgccagGTCGCGTCTCAACCTCAGCTGTCTAGCGGCATACTCTCTCC
AGCTGTGCTCATCAAAGCCGTAGTTGAAGTAGTCCGAGATATCCACGCCAGGCTTGCGCCAGGGTCTGTCTTCTAGCAGGTCGATATCCACATCAAAGGC
CGTCCGTCGTCCGCCGAACATGGCCATATCGTCCACTCCGTCAACTGCAGACCCGCCTGAATCTCCAGTTTGAGAGCCCGTCATAGCCCCAGCCCCCGGA
GCTCCAGGTCCACCCTGTTGAGGACCTCCAAAGCTGCCGCGGACGTAACGATTGCCGCCGCCCGTGAAGCGCAGCGTAGGCTTACTGCCAGCATGATCGG
TGCTCAGCACGATGGCgacatcttcatcgtcctcgtcgtcgtccgagtccgCCGCTGGGTCGCCACTAGGCTTAGGTCCTGCTGGTACATTActggcagc
tgcagaagccgctgcttcgGCCTGCGATGTGGCAGAAGCGTTGAGCTTGATGGAGACGCCCCCGTacagctcttcgtcttcgtcctcgtcctcgtcttcc
tcttcctccttcttctcagtTTTAACAGCAGACGCGTCGTTAGCTTCCCATGTAGCTCTAGAGTCTTCcgtcttggcctcctccttgacGCTGGCGCCTG
CACGCGTGGTCACTAGCACCTCTTCCCCGAActcttcgtcctccatgGTTCCGATACCAATAATGGAGGGGTGGTGTAATTTGTGAACAGCAATAATTAT
TGTCTCGTCAAAGTCCGAACCCACAACGGGCCGGGTTTACCAGCCCGTATTCGTACTTATTCGTAAGGTTAAAGTAATTATTGTCCCGACAAAGTCCGAA
CCCACGGTGATTGGCTCGTGGGGATTTTCACTTGCTCTTTGTATGTTGGCGCCTCCGCGGCCAATAGTTTCACGGCCAACGCCCCAGCCTGTGCCATCGC
TCACGCAGTTCATCTTGTCTCGTTCGACTTTAGCAGGTAAGCGAGGCTTCTCTGGCATGCGATGGCTGGCCGTATCTACTGGGAGACGCAGTATGTGGAC
GTGACGAATAGTGGGGGCACAGATACACCAATCAAAATGGCGCGGAGACGAGCAACAGAGTGAGGATAATGACGGAGATACAGGCCAACACGCACAGAGA
CTATAACAGGCGAAGAATGCTCCGTTCCGCCGCGATTCCGGTGTTTCCAGTGCGGCTCCCACTTCAGTTGTTTCCACAGCGCTGTCTCCTAGTAGATGTA
GCCTTCAGATCGCATCCGATCATGCCCGGAAATGCAGCTACTAACGGATATGTCTTCCTTCCTGCAGTTTAGTCAAAGATGCCGCACTCCTTCGGTTACC
GCGCTCGCACGCGCGACATGTTCGCCCGCCCGTTCCGTCAGAGCGGCATGATCAAGATGTCGACGTACCTGCGTACGTTCAAGGTCGGCGACTACGTTGA
CATCAAGGCCAACGGTGCCGTGCAGAAGGGCATGCCCCACAAGTTCTACCACGGCCGCACTGGCCGTGTGTACAACGTGACCAAGCGTGCCGTCGGCGTG
CGTGTGAACAAGATCGTGGGCAACCGCATCATCCACAAGCACATCAACGTGCGCGTTGAGCACGTGCACCAGTCCAAGTGCCGTCTTGGCTTCCTCACGC
GcgtcaaggagaacgagctgaagaagaaagaggctCGCGCTACTGGCGTCCGCGCTCAGATCAAGCGTACCCCCGTGCAGCCCAAGGCCGCTTACACCCT
GAAGACCAAGGGCACGAAGCCCATTACCATGGCGGCGCAGCCGTTCGTGGACCTGATGTAAGTGGTTCTCGGTGCGCTTCACACCATTGCTACGAACACA
TTGTTGGGAATCTTGCGCTTGCCTCGCGGATAGGCTTACGCAGTCGCTCCCGGGCGCGTCGTAACCCCAACGAGCTGGGCTAAATGAAAGAACGAGTCAA
ATCCACCTCCGCTTCTTTTCCCCTCTTC