Description :
From Genome Similarity Track
Location :
Scaffold_290:85- 4104
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_290-abinit-gene-0.16Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_290-snap-gene-0.5Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_290-snap-gene-0.6Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_290-snap-gene-0.7Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_290-snap-gene-0.8Chromodomain protein

Sequence
4019 bases(100 bases per row)
AGCTTGTCTACATTGTGGAGGCCACGTCTGGTCCGCAACTGCAGTACAGTCAGCCCTGAGGAGGAAAAGAAGATACTGGAGAAGCTCCAGGAACGCAAGA
AGCAGTGGCAGAAGAAAAGGCAAGCGAAACGCGAGCGACGCGCGTGAACCCTTCGGCAATGGCCTGCCTGAACGGCGCGGCAACCATACAGTATTGTGCT
GACAATAGCTCGAATTGGAACATTGTGTCTGCACAGCTTGTTCGAGAGCTCCAGCAGAAAGACCAGAGTGTGGTGGTGTACGATCTCCGCGAGTCTGTGG
TCTGTCGCACGGTGGGCGGCAGCGTCACGTCCTCGAAGGATGTGGATCTTTTCGTGACGCTACACACGGCTGCTGGCCCAGTGCGCTGCCAAGATAGCAA
GGGGTGCCTGGTGGTGAGCAATGACGAGGACGAGTTAATTGTGGGTAAACCGCTTTTGATCGAGCTCGGAATCGACATTAGTCGGCAGCTAGAGATGCTG
GCCACCCAAGCAGTGAACCTGGACGCAGACGACCCCTCCAAACTCGCTGAAGCTCCTGAGCCGCGCGCGTGTGTGGATGTCAGTGAGGCTGAAGCAATCG
AAGGCATGCTGGCAACTGCGGTGCGAAGAGATATGCCTAAGGAGAACCTCGAGAAGCTGCGCGTCGTGTTCTACATGTTCGATATCTGGCGCTTGGTGCT
TGGCGACGATCCTCCCTCGAAGGTCGAACCGCTGGAGGTCAGGTTGGAGCCAGGTTCGAAGCCGTACAAGTGCAAAGCGCACACATATAGCCCCGAGACG
TCAAACCATCTCGGGGGCTTCACAAAGAGTTGGTGGCGCTTCGTTGGGTCTACGAGAACGTGCAGAGCAGGTGGGTTTGTCCAGCGATGCCAGTTCGCAA
GCCGCACTCGAACGAGTTCCGCCAAACGAGCGACTATCAGCCAGTTAAGTATTATGCAGCTTTCGATTTCCTGAATGGATTTTGGCAGCTGCCCTGGCGA
AGCGAAGCCAAGAGATACTGTCCTAAATGACGGAGAAGAAAATCTACACGCCGAGGCGGGTTCCTCGAGGATCGACGGACGCCGCGCTCCATTTTCAAGC
GACAGTGGAGAAGGTGTTAAGCGAGTTGCTGTACAAGAACTTACTCGTGTGCATTAAGGATTTGCGGATCTTCGCAGACTCGGTGGAGGAATTGGTGAGC
GTCATGCAGCGAATGTTTGAGCTCTTAAACTAGCACGGGTTGAAGCTCAGCCCGAAGAAGTGTGAACTTTACCTAACCGATGTCAAATGGTGCGGGCGCG
TCATCAGTGAAGCTGGCGTGAGCCATAATCCTGAGTGGACTGAAGCGCTGCCGAAGATCCCTTATCTGAGAGCAGTCGCAGAGCTGTAGTAGTTTGTCTG
TGCGACGAACTGGCTGCGTAAAGGACTGGTGGACTACGGGTGAGTCGCCAGCGGCTAGTGTAGCCATTGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCCGAGGAGAAACTCACTTTCGACGAAGTCAAGCAACGCTCTCACGCTCCG
CTACGCTAACATTCCCGTCGCCGTTGTCCCAGATGTGAGTGCTGACCGATGCTTCCGACAAAGGCTGGGGTTTCATTGTGGCTCAAGTTCCCGATTGGAA
GCCAACGACGCCGATCCAAGAGCAGAAGCATGAGCTTTTGATCTGCATGAGCGGGCGTTTAAAACGCAGCTGAACTGGACCGTGCTGGAGAAAGAGATGT
ACTCGATCGTACACGCGTGCGAGAAACTCGAGTATCTCCTACTCAGAGCTCAAGGGTTCATGATGTACTGCGACCATAGGAACAACGTGCACCTGTTTGC
GCTGGGGAAAGCGTCGAAGAAACACACCCGCGGCAAACTGCTTCGCTGGTCGATGAAGCTTCTGGAGTACAACTTCCAGATCGACCATGTCGACAGCGAT
AACAACGTTTGGGCTGACCTGCTGCCGCGCTGGGGTGGCGCCAAGAACCTTGTTGAGGACTTTGACTCGGCCGTGGGCCAGGTTGAGACGCGTGGGCTCA
TTCGAGACGCATCTTGCGCTCGCACAGGCAACAGAGATCAACCCACTCGGCACAGTGAACTCGTGGAAGACACTGGGGCAGGAATACCGCGTGGCGCGGC
TCACGAGCAGAGTGCAGGCGCTTAGCACAGCACAGCTTCTGGCATGGCTGCAGACGCACGGCGGAGAGTGGTGCTCACCAGCACTAGCGCCAACTTGAGC
GAGAAAGTAGCCTATGGCGATCAGGCGTGCACGTCTGCTTCTGTAAGGGGCAGTGGCGACGGTGATTGGCCTCCAGTGGTGCGTGCCAAGAAGCTCACAA
AGCAGCAGCGTGTGGACCGCAAGATCAGACCTCTGGACGCAGAGGGATTTCTACGGCCAGCGTTGCAAAAAATCGCGAGTGCGCAATCGAAGCACACGTC
ACCTACTGGCGCTGCCATAGATGAGCGTGAGGCCTTCATGGTTGACAATTGGATTTCAATCCCGGGCGCTGAGCACGAGTTGCTTGAGCGGCTCATGGTG
ATCTCGCATTGCGGTTCCTGGACCCGGCCACCGAGGAATCCAAGTGATGCGACAACAGCTGAAGACTGTGTTCGAGCTGGAGAACCGCAACAAAGAGACG
CAGCGGTTCTGTAGCGAGTGTCTTCTTTGTCTTCAAGCGAAGGGGGGAGGACAATTCCGCAACCGTGGGGCGAGATTCATCACGCGCATGAGCCCAACGA
GGCTCTCCACTGGGATTTCTTGTTTCTCGGAAGCTCATTCGAAAAGCAACTACCTCTTGGTGCTCAAGGACGCGGTGACCTACTACACGGAGTTGGTGAG
GTGCACTAGCCCGACGGCAGAGGTGGGGGTGACAGCGATGCTCGACTGGTACAATCGTTTCGGGTTGCCAAGATTGTGGGTGAGCGACAGCGGCTCCCAC
TTCAAAGAGCACGGTGATCAGCGAGCTCTCGAGCCGATTGAAGGCGAAGCAAGAGTTCATCGTCGCGTACTGCCCTGGAAAAACGGAACTATCGAGTGAA
TCGTGATATCCTCCAGGTGCTGCGGGCGCTGATCATGGACTACAAGGTGAGCCATCCTGACTGGTCATACCTGATTCCGTTGCTGTAATCCAACATCGAC
AATTCTCGTGTGGAGTCGTTCGCGAACAAGGCTCCAGTCGAGTTGTTCACGGGTCTGCCCTGCGCGCCGCCGTTGACGGTAGTGGTAGATCCACACAAGC
TCAAGTTGCTCGAACGCCCTGATCTTCTAGAGCGGAGAAGATTGCGGCGTTCGAGCAACTCGAGCCTGAGACTGAGAAGAAAGTGCAGAGCCTGCGAGAG
AGTCTGCGCGTGATGCGCTCGGCGGCTCGTGTTCAGAAAGAGAAACGAGCGCGCTAAAGCATGGAGCATTACAAAGGCAAAACAGTGGAGTTTTCGGTCG
GAAATTACGTGTTGAAATCCAGAGTGGACGAGAGCAAGGATCAGGGCAAGCTGATCGTGACCTAAATCGAGCCGTACAAGATCGTCCAAGCGCTCGAGTA
CGCGTTCATGGCGGAGCACCTCCTCACGAAGGAGCGAGCGTGCGTCCACGCATCCAGACTGAAATTGTATCATGACGGTACTCTCAACGTGACCAAGGAG
CTCATCGAGCACGTGGCATGCTGCAGGGCGTGGACCAGATATGCGAGCGACACCACAATGACGAGGTGAAGTCTTTCGAGCTCAAGTTCAAGTGGCTGGG
ATTCGCGGACATCGAGGACTCGTGGGAACCGCTGAACAGTGTTGCTGTGGACGTGCCTCTTCTGGTGAAGAGGTACTCAGACCAGAGCGGTGATCCTGAA
CTCCAGCGCCACTGCACTA