Description :
From Genome Similarity Track
Location :
Scaffold_2146:85- 3006
Sequence
2921 bases(100 bases per row)
AAATCTACCTCTCTCAATTCATACAATACCACGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAGCTGCCCAAGAAGGATTGCATCG
CCCGTAACGACTGCGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCACTCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCGG
GATGTCACTCTTTCGCACAGCTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGCTCCAGGATCCC
CTGGCTCTCCTGCTTCGAATGGATCCACTTCCGTATGATCTTCCTTGGATCCACCCTTTTCGGGTTCCGGTATTCGAGTGAATCCATAGAGGGTGCTATC
GATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAGCAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGA
GCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAG
GCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATACCCACCCCGTTCTTCTTGATGATGATTACCACTGG
GGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCACTTAATCAGATCCGATAGGTTTTCTCGGAACTGAGGCGCCATCTTCCGC
ACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATTGCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTC
GGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAG
TGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGGTCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAAACTTGCTCATCTTCCGTCTTCATAGGA
TCCACAATTGGATCCAAACACCGCGGCCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGAATCAGGTACCCTGGTATCAGGGAAACCAACAGTTGGAT
CTAGTAGGTCCTCTAACGAGTTTAAGCCCGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAAGGATCCAGGCACTTTATCCCATGGAAAGCTTGG
ATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAACCCTCTGCAATCCTTCATCCACCGACCCCGCGTTATCTAAGGGCCGACTCTGGGGATCG
TCCCCCGTCGTGGATCCAACCTCCCTTGCTTGGATCTTAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGG
GGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAAATTCTGCCATTCTTTGTAACGGCGGGATCC
CACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCCGTAATAGTCTCATATCGCTGACGTTC
GTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTA
ACCGATCTGGCAGCTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGTCGCCGTCCGCT
GAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCT
TGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACGCCAAACAACCTGCCAGCGTGATCTTGATCCGTGTTCTCCCGTTCGTACGGTACACACCTT
CACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATC
TAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGAGCATGGTACTTCCAGTATCCACGGGCTCCC
CGGTTAGCAGATCCATGGATCCTGCATCCTCAGATCCATGGGATCCAGTGACCTGACAAACTTTAAGGGGATCCGCCGTGACCTCACCCTTGCTAGGCTC
AAACCATCGACCATGTTGACGCGTCTCCCAGTAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACT
TGGCGCAAACTAGAGATCTTGACAGCTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGACGTTTTGT
TCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAAC
ATCCCTCCGTGTTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCGAC
ACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCATACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCA
CTGTGAACACCTGACTTGTGC