Description :
From Genome Similarity Track
Location :
Scaffold_2111:85- 2530
Sequence
2445 bases(100 bases per row)
GATCGCTCAAAGAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAACCCAGGCAGGTATAGGCTTAAATATCAATACAGACCCC
AATTTGCACTGTGGAGAGCAAGTGACCTGTAGTCGTCTCGGGGGTTGGATTTGGCCTCGAGCGATCGCCGTAACAGGAGTGAACATTGGCCCTGGACAAG
GACAGCGTCTACTTCGCCCGCCAAGCATCAGGTCTCACTATGGAGTAATCAAGATCACGAACTAGAGAACAAGTGGGCACGGAATCGTAACGGGATCATC
AAGTGGAGATCAACTACGTAAAGCGTTTCGACGGGGATTGGATTTGGCCTTGCAGAACATTCGTAGCGGAGATGAGCATTGGCCCGGACAAGTTTCGTGT
ATACTTTGACCCTAGGGACTAACCCAATAAATAAAGACTCCAATTTGCACAGTGACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCC
GTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTT
ACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGGGGCTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTAC
GACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCTAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGC
TTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGA
ACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCG
TTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTG
GTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAGGACGCTGCT
GAATGAAACAAGATCCGCGAAACGATGGAGTTTTGGGAGGAACTCTGTCGACGGAGAGAGGTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATC
CTCTTCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGGAACCAAGATCTTCTGATCTTCAAGGAAAAGTTCTCGCGAATCGGCTTGCATTTGCTGATT
CACCGGTTAAGCCCACATTGTCCCTAAACCCAACCTCGCTAGTCGAAGAAACGAGAAAGAAGACGATAACCAGTAAGACTATCCGGTTCATTATGGTCGC
TCCAGAGTCGGAAGTCGAGCAAGTTGGATCCAGGTCAGGCTGGTCAGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCAT
CAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGAGAGCCGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCA
AGGATCTATTACGTATGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGAC
GCGGAACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAGAGGTCGCGCACTATGGATCCGGTGTCGTCGCCGAAGGTCAGACTAAGCTGCATCCTCGAA
CTACGAATCCCGCCGCTGAGGATGAGTCAGACACGTCGTCCCGGAACCACGACGCGTGACTTTAGGACCTCCGGGGCATCCATGTTGGAAGCGCGGGCGA
GGATCCGGGGACAGGAAGTTCCTTTGAACGTGAAGACTCGGGATCCCAGTACGCCCTACCCGTAATCTGACACAATCCAGCCAGGATCGAGCCAGATCCC
GGCAAGAAGCCAGTGCGATTATCGTCAGATCAGGCTCGATGTAATCGCCTCACGGACCCTTTCTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACA
CTTCCTCGGGCACCCTGCAGCGGCACTTCGAAGCTGCGATGAGTCGTTTTCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCA
CGAACATGGAGCACGAGACGTGGAAATGGAGTCAGTTGAGGAAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATAGCCCATCCACTTCGTCA
GCAGTGGTAGCAACAGCCACAGCCGGGGCAGGAGGATCGTCCATG