Description :
From Genome Similarity Track
Location :
Scaffold_623:85- 1593
Sequence
1508 bases(100 bases per row)
GGTCCGATCCGGAAGACGTCTCCATGGCACAAGCGGAAACCATCCCTCTGTGGATAATGTCGGTAGCGTGTACTCAGGCAAAGAAAGGTACCCATTGTGC
TCTGAGCGTCCTGTACGAAGTAGTCGTCCCCTGCTACAGAGATTTCGGCATGCACTGCGTCCATGGATTTGTCCTTTGTCACTACGAGCGTGCCTTCTCC
TGGGTCGCACCCAATAAATCCTGGTCCGAGAAACCAGGACTTCTGAGACCGCGTTCGGCCACGGGCAGTGGATCGAGGAAGTACGATGCATAATTCCTCC
TTCGCTCGTAGCCTACGCCGCGGTTTTCCCGTTTGTTTTGCGATCGATGCATCTGCAGAAGAGATCATCACCTCTGCTCGTTTCTCAAAGAGAGCTTCCC
CTTTGAATGAACCTGTCGATGTGATCCCGGGCGTGTGACTGCGACGACTGCTGCCAATAGAGCGTTGACTGATGACCGATCTCTCGAGTCTATCTGTTGC
GATGCTTGATCTTCGCCGCTTGAACAAATAGGAGCGCAGATCAAATTCTGTCGGGTTGTTCAGGAAGACGATATTATCGTTGGGATCATTAGACCGACGT
GTAGCTGAGTTTATCCCAGTTGATGATTGATGCTCCGCAACAACAAACGAACGCAAGCCTGCAGGAGTCACAGTTCGTCTGCGTCTCCAGAAAACTCGTA
GACCTTTTGCTGGCCTGGTGCTTAAATGTCTTTGCGATGCAGACCTTGAGCCTGCATCGGAAGATTCCGGTCTCGCTGATCTGTGATGGAAGATCAGAGT
CTTTCTCGAAGCACGTCGAGGATCGGAGGGCATTGTCGTCGGGTCAAATACTCAAACTTCCAGCTATCGGTGGTGGGCTGGCGAAGTTGAGACCACAAGC
AGGATTCGAGGCCTGAATGAAGTCTTGGCGAGGCCTAACGCTATCAATAGTGTTTCGAGATGTAGGATAAGAATGCTCGATCCGTCCTGGTAAGCCAGCA
GCTTATTTTTGTAAGTCTCTGCAGAATTCTACAACACGATTACAGTCACCACCACCGTATGAACATGATCGACATGATTTGACGTCGCAGTTACATTCTT
GGAATGTGCACAATTTCCCGGGAGCTGCTGGATCAACAGTAGTTAATGTAGAACGACGCAGCGAATAATAGTAAAAATGGCCGGTGGTATCGGTAGTATC
GACGACGGATGTATGTATGAACTCTCGCAGGAAGAAGACTGCCTCGGAATGATTTGGATAAGTCTACTACTGGAAGAGGTTGAGTTGGTACCAACGCGTA
AACGACCCCGCTGTCCGTACAGACTTTTGTGAATCAGCACACACGCTTTGGACCAGTGGAATACGCAATCAACACTTTCTTTCAAGCCGAATAGCTGAAA
ATAAGCACTCGATTTGTTATTTTTGATAAAGCAAGAGCGTTGCTCGAAAATCGAAGAGAGAGTTAGTTAACCAGCATATCTGAACCTCTTTAACCCCCCT
ACGCCCAA