Description :
From Genome Similarity Track
Location :
Scaffold_2081:85- 1511
Sequence
1426 bases(100 bases per row)
CGAGACTAGTAATTCCCAAGGAACTCCGAGAGGAGATTCTCCAGCAGTACCATGACGACTTTCAAGGCGGACATCAAGGAATTCTCAGAACATTTGAGAG
GCTCAAGAGAGACTTTCACTGGATCGGCATGTACGCTGACGTCGAACGGCATGTGAAGGAATGCGTCGACTGTACGACCGCGAAAGGAGTCCCAAGAAAC
CCCGGACCGTCACCAGGCAACATATTGCCTCTGGAACCTTTTCAGATAATATCCATGGACTTCGTGATACCGTTGCCACCATCCAAGAAGGGAAATACGG
CACTGCTGCTGTTCCAAGACATGTTCTCGGGATATGTAGTCTGTGCCCCCATGAAGCGCACCGAAGCACAAGATGTGGCTGAAGTCTATGAGAAGAAGGT
CTTCAGATACTGGGGAGCGAGCCAGATTCTCCGGCACGACCGAGATCCAAGGTTTATGTCGGAAACGTTCCAACACTTCAGGGATCTCATGGGAAGCAAA
CAACGAGCCACTCTCTCCTACAGACCACAGGCTAATGGGCAACAAGAGCGTTCCGGACAGACAATTGTGAGGAGCATCAGAGCGTATATCGCAGAATCGG
ACCAAGGAGACTGGGATGTAATTGCAAAGCGTCTGACGACTTGCATTAACAACTCTTTCGACTCCACAAGGATGGAAACGCCGTTCTACCTCACACACGG
CTGGGATGCGTGCACCACAATCAAAGGATCGCTTGGACGATGGCCAAGAGCGTTGACCCCGAGAGCAGCTTACCTCTGGAGAGCTCAAATCCAGCGGGAC
TACGAATACGCGAAGCGATGGGCTCTAGACCTTCAGAAGAAAGCGAAGCAAAAGAGATCAGAGCACAGAACGGCGTTGTGGACAGCTCTCTCAGAGAAAT
TCAAGAAGGGCTTCGATGTCGGAGACGCGGTGTGGCTGTACATTCCGAGGGTGAAGTCGGGATTGAGTAAAAAGCTCGCGCACAAGTGGCACGGCCCGTT
CAGAATCTCAGAGAAGGGAAGCGATTTCCGATACAAGCTGAAGATTTACCGACACGAATATCGCTTCTATCCCTGGGTGCACGTGAGTCGTCTGAAACCG
AGAGTCGTCTACCCTGAGAGGCCAACCGAAGAATTGTCCGAGGTTCCAGAGGAATATGACTTTGACGCTGAATTGTTGCCTGAAGACAGCTGGGAACCCG
ACGAAGAAGGCGGTGAATACGAAGTGGAGGCTCTGGCAGACTGCCGATGGACCAAGGCGACAAGGAATGCCCGTCAGAAACGCGAGTATCTCGTGAAGTG
GAAAGGTTATGAGGAGCTCGAGTGGGTCCCCAGAGAGAGACTGAATTGTGGGAGCCTGCTCTACGAGTTTGAGCGCCAGAACCGTTCAAGAGCACGATTT
TCTGCGATGCAAATGGCGGATGAGGA