Description :
From Genome Similarity Track
Location :
Scaffold_109:84978- 87579
Transcript NameFunction/comments
Physo_142160hypothetical protein

Sequence
2601 bases(100 bases per row)
TTTGAGTGGTACACGAAAACCCCTCGCATCTGGGAAGTCTGTGACGATCGCTTCAGTCAAAGCAGATTGTCGCCTTCATGAAGCTATTCCTACCTCTGGG
ATTCAGCCTTGACCCCACCACGGGTGGGCACGCGGATCGTGTCATGCAAGCTGGCAACACAGCTCAGAAGAATATGCATGAGTTTCTTCAAGCGCGAGGT
ATCAAGCGCAAGTTCGGCAGGGCCTACTGAAACAACTTCGCGCACTTCATCGAGATGGAGCTCTAGAGGAGTTCATTACCCGGTACCGGGCAAGTTTGGC
TCTTGGCCAGATCGCCGACCCTGCTCCTGAAACGACAAAGGAGTGTTTTTAGAAGCACTTTGGGAGTTTGGAGAAATCATGCGACTTAACAGTTTGATGG
AGTTTTTAACCTATTAAAGGAATGAGCTTAAATAAGAGCAAATACACTTCCCATGGTTCGTTACACATTCAAACCACTGTGGCATACATTCACCATTTTG
CAATCGCCAACACGAAGCCGATGGTTCACCTCAGATAGAAGAAATTCAAGCGCGCTGTTAGAGCATTTATTAGGAGTTCCCCCTCGCGTATGTTACAGGT
GATGTTTTACGCTACCTTCGCCACGAGCTGCGTGACCAGGTTACCGAGGCTCCAAGCCCAAGGGATCGTTGTTTGACGTCCTCTCGCCGTTGCAACAGCA
GACTGGTCGTAGAATCGAAGGCCACCACGTTCTGGCATGGCGCTCTTCGCGGCGCCCCAGCCTCCGACATCTTCCCAGTACCGGCGCGAATGCACCCCAT
GCAGCTGCCCACGAGTCGACCCAGGCGCGCGAGGCTGACGGCAACCTCGCGCCAGTCAACACTCCGCTAGGAGCTGAGGGGAATGGGGCGCCGTTGCCAC
TATCGCCGCCGCCACCGCTTGGACCAGCACTGTCGAGAACCCCGCCAGCACTGCCGCTGAAGCCATACCCACCAGCACAGCTGTTGAAGCCACACCCGCC
CTCACTACTGCTGCGAAGCTTGCCACTGATGATGTTGCCGAAGAGAAGCACGCTGCCGCTGGTCCAGTTGCAGAAGAGAAAGACGCCACCGCAGTTCCTG
CTGCCGAAGAGAAGCTCTCCGCCGCCGCTGTTCCTGCTGCCGAAGAAAAGTTCTCCGTCGCCGCCATCGCCGTCGCCGAAGAAAAGGTGATCACCGCCGC
CATCGCCGTCGCCGATGTGAAGGTGACCACCGCCGCCTCCAGTGCTGACGCTGCACAACCGCTCGCTGATTCTGGTGACGACTTCAGCGACGACGACGTG
GTCTGGATCCCAGCTCCAAGCGGTCTACCTGTCACAACTAGCACCGGTAGCGTGCTCAATGCCGACGATGGGCGCGACGACAGCGAGGCGAGCGAGGCCG
AATGGGTCCCGACGGAGAACCTGGCCGCTCCTCCTTCCACAGCTCCGCAGCTCTACAACATCCGCGCAATCACAAACTCATACATGAGAAACGGTAAGAG
AGTTTACCTTGTTGAGTGGGAGCATACTGAAGAGCCTGCCACGAATCTGCCTCGGAACATGGTTGCCGCATACAACCGACGCCGCAGAGCCCTTGTCCGT
CGAACCTTCATTGAAGACCAAGCTGGCCAGGGCCGTGGACGACTTCGAAACTCGGAACCTGCACCAGAGCGCCGCCGTCGCCGACCACTTCGACGACTTC
GCAGAGCTCTTCACTTCTAGATAACACAGGCACAAGACAATAGTTCGAAAGGTTCAAGCGCATATATTACCATTGAGGAACGACTACCCAAGTACAACTA
GGCTAAGCTGTTTTCGCGGCACACCAAGTTTTGGGTAGTCTTCACCTCGCAAAACAGCTAGGCTACGCCATAGGATAGCACACCAAGCGTAACAGCCGCA
CCACAGCCTACATTAATGCATACACACTAACACCAATACCAATGAACGTCAGACACGTGAGCCCAATATTATCAAGCTTCCCCAGTGCTTACCTCATCAT
CTCGCCGATGTCCTTGGTCCTTAGTCCATGCTGGAGCTGCATGCCGCGCGCCTTTGCTGAGTTGCTGCTGCCGCGGGGGACCCGCCTCCCCCCACGCGCA
GACGCCCCTTGCTCGCTGGCGCCGCTCCTGATGTCTGTCTGCGTGCTGGTTGACATGTGTTCTCTCTGTGGCCTGTCCTTAGCGACATGTCGTCCTCGCA
TTCTTTAAGCCAATGATAATTTTATTGGGGCGAAGCCCCCCCCCCCCTATAATGAAATCGCTCTGATTTGCTTTCTTTCGATGAATTTATGGATAGGGCT
AGGGAAAGGTTTAATGGTTGCCTCTCCTGGGGGCAAAAACACAGCAATTTACCTCTGTATAAGATCATTTCAGGCTCAATGTCCGACGGTTCCGAGTGAC
TATTCATAGAAGTTCAGGGACGTAGCCTCCAGCAAAGGGTGCGAAAGCCATTAAACGGAGGCCCTTTTAGGAGGCCTCTTCCAAATAGGGTATCTATGAG
CTGTGAGCCTTCTAAAGTGGATTTGGCTTAAAACCGCATTATTTTAGCTAAATGGGTACTCTGCTTTGCTGAACTATTGACCCTGCTTTAGCGTCGTATT
G