Description :
From Genome Similarity Track
Location :
Scaffold_3:8497- 9500
Transcript NameFunction/comments
g18677.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
TTGTCTTTGACGAAACGGCACTTCACCGAGCTTGTGGCCTTGAAGTTGTGCCGAGCGTACGTCCACTTCAGGATGCACTCCCAACGACAGAAAGGCAGAG
TGTAGTCTGGATTTCACACCCAGAGTATCGGAAATTCAGGATGCACCCCAAACACCAATAGCCAACAAATACAGAGTTATATACAATACAAATAGCCGTC
ACTTATTGTTATCGACCCTTGGGCGGTGGGTCACTCGCTAGGCTCACTCGAGTCTTACAATTCAGACACCTAGTCAGTCTGAACACTCGTATAAAACGCG
CACCACTCTCAATTAAGAGAGAAACTATCAAATGCTATAGTCAGTCGATACACACAGCAGTTAAACTATCACTTCGGGGGACAACTGCTAGTCAGTCACC
TCGAATAGCAAGGGAATATGAAATGGGCAAACACCAGCACGCTAGCGACCCAACTAGGATATGAAATAGGTGGGTCAACCCAGGGTGCCGGAGCGCCTCT
GGTCACCACCTAACTGGACTTGATGTTATGAGGTGGAGATGCCACAGACGACCCGTCCTTAATGGTCGCAGCGCCTCTTGTTGTAGCGCGGTCGTAGTCT
CGGGACCTCCGGATTTCCGTCGGCAGGCTTGGCCGAATTCACTTGCGCAGTACGGGGTAAAACAAACTCTGTTGTTGGTTGTAAGCCTTAAACTATCAAT
TCTTTCTAAATCTCGGTTCTGAGTGATTTATCTTGATTTCACTATGTCTTGGGTCAAATTGTCTTTGCTTCAGTATGGTCTGGGTACATTGTCTTCGTAG
CTTCAAAAGTGTCGACTCGACAGTTCTGTTGGGTTCCTTGGCGGTAGTTCAATTGCGTTTCACTTGATGACGTACCACTGTCTTCGAAGTCAAATAGTCA
GTGGTCAACCGTCAAGATTCTGGTATTCTGGAGTCAGGATTTTGGAGTCAGGATTCAGGATCCAGGATGTACTTGACATCCAGACTCTTTGGGCTTCCAG
CGC