Description :
From Genome Similarity Track
Location :
Scaffold_84:84965- 87800
Transcript NameFunction/comments
Phyci_95129Hypothetical protein
Phyci_234757Hypothetical protein
Phyci_234777Hypothetical protein

Sequence
2835 bases(100 bases per row)
GCTGCGGCGGCGACGGTGGCGCTCAAGCACCGCCAACAGATCACCTCGGTGGTGACTCGCAAAAGGCCCAGCTCGTGACATCACGCCCGCCACCAGCTGC
ACACTTGGTGGTCCCAATCAGTATAAAATCAACCTGTCTTTGCTTATGCCCAGAAAAAGACTCCGGTGGCGTGTGAAACCCTGGACAGTGACGCTGTCAC
TGTCATGTTACCATTCGAAGTCGAGATCGCGGCTCGACGCGCCATGCTGGCGAGGACGCCACCACGCGACGTGCGCGCTCACTCGCACTCGCTCGCCACA
AGGAACAGGCCGATGCCGACGATGGAGGTGCTGCGTGCACGTCTGGTGGCCGCCGTGGCCAAGCTGGTGCTGCTGCCCGTGGTGGGCGTGAGTCTCTGCG
GCGCTGTGACCATCATGCTGGGGCTGCAGTGGATGGAGACGCTGCAGCGCCAACGCCAGGCGCTCAAGTGGCGTGCACGCCTGTGGGCTGCGCTGCTGGC
GCTGCTGCTGACGCTGCTGCCGTCGAAGCGGCTCGAGGCGGCCGTGACGCCCGTGGATGGACTGGAGAAGGGCAGGAGCGAGCTGCTCACCAACGGCGAC
AAGAGAGACGCCCACGACGGAGACGTTGGTGGAGAGGACGACGGCGGCTACGCTTCTCGCCCTCTGAAGCGACAGAAGTCGGGGCCTGGCGAGAGAGACG
ACGCCCAAGCGTCTGGGCGGGAGGATGGGCAGCAGGACGGGAACGACGAGCAGGGACAAGCGGGCGATGAAGAGGACGGAGGAGATGAAGGTGAAGAGAC
GTCCAATGAAGCGCTGGGGACTGGAGAGCCGAAGAAGCCCCGTGTTCGAAGGCGCGTGTTCATCTGGGACCTGGACGAGACGCTGGTGCTCTTCGCGTCG
TTGTATACAGGAACGTTCGCCCAGACGCACGGCAAGGAGATCACCGCGGGCGTAGCCCTCGGAGAACAAATGATGACGTTTTTGCTGGCGATGCTGGAGA
GGCACTTCTTCTTCAGCGACCTGCACGACGCGGACGTGGACCATATTGCTCATGTAGCTGCGTCGTCGATGGAAAATGAAACTACTGAGCCGGGTCAAGC
TAACGCACCCGAGCAACCAGGACTCAGTGTGCAAGACAGGTATGAACGCATTAGGGAGATCTATGAACGCCGTGGACACGTTGATTTCTTGAATGATTCA
AACAGCGAGTGGTTTGCCATTCGCGGCGCCCTCGTAGCCGCCATCGACAACTTCTCGACGGGCTGGCTGCATGAAGCCCGACAGGTGTTGGAGCTAATAA
CCGAGTCAGCACAATCCCGGGCAGACTTACCACAGCCCGAAGTGGAAACGGGAAGTGCGACGGAGGGAAAAGAGAAGGGCGAAGAGGTGGAGAACGTGAA
CGTGCTGGTCACCAACACACAGCTTGTGCCAGCGTTGTGCAAATGCCTCATCTATCAATTGGATACGTTTTTCCCGATTGATCGAGTTTACAGCTCAGCG
AAGGTGCACAAGTATCGGTGTTTTGAAACTATCCTAGCGAAGTATGAAGCACCAGACGTGGAGTTTATCGCTATCGGAGATGGACTCGAGGAGGAGCAGG
TAAGCCTCGCGCTGGGGATCGAGTTTCACAAGATTCGTTCTCTCGTGGACCTCAAGCGGCTACGATACGATCTGCAGCTTGTCCAAGTGAGCAGTAACAA
TTCGTCGCCGCCTGCCGCGGTAGTTGACGCTCCTGGCGTAGCTGCAGCGCAAATATCGGTCGCCTCCTCCCCCGTTGAGCAAACTGCTGTAGTCTAGGGC
ATCAGTCGCCATTTTCATTTGTAAGCTCGATGAAATAGCGTGTTATTTATTCATGTCGTTGTGAGGTTCTGTCACTGAAGTTTTCCACTGTCGACAATGG
TGCAGGGCACGCTAGGTCGTTCGTGACTTGTCTCCAAGCCGCCGATGGTCATAATAGTCCGCCAACCACTCACGACTCGGCCAAATGCCACTGAGTCAAT
GCACGCACATACATGTATTAGTTCGCAAAATAATTAGCTTAGACGAGACGAAAGAGCATTATGTACCTTTGCGGCGGTCAAGCCACGGCTGAGGTGCCAG
GGTTATGAAGAATTGAGAACCGTTCGTGTGTGGGCCTGTATTCGCCATGGACTGCATGTATATAAAATGAAAGCCACAAGAATGCACGTGAGGTAGCATC
AGCTACACAAGATAAACACACAGTTATTTGCGTACGAGAATGCCAGCAGCGTTGTGTGATATGGCGAAGCTTTCATCGGCAAACGCAATGCCGTAGAGAG
ACCGGCAGGGCCCGTCTCCTCGACCATTACCGCCGACATCACCTGCTTGAATCCAACCGCCACGAACAATGCGGTGGACTGGGTTACCGCGGTAGCCTAG
TTCCTGTGTATCGTCGTTAATATCAGGGACTTTGTGCTCACAGAACGCTAGGAAATTCTTGCACGTCTTGGGACACACATCGTGGAACAACTCTAGCTCT
ACCCGAGGCAGCGCCACACCATCCACTTCGAAGACTAAAAAAGCGAATTGATGACCAGACTGCTCACGATGACGCGCCAAGGCTTGTTGCACTGCTTCCT
CCGCTTTTGCCTCTAGTGTTTCTTCTGCAAGAGCTAATTTCTCGTTGTACTCTTTTCGAGCACTATCCGAGCCTTCACTGTCATTCCCAAGCACAAGGAC
GCCCCCAAACGCCGCTGCAGCAAGCAATTCGTTCCGCGAGAGCTGCGTCCGCTCAATCGCGAAGTCGAGCAACTCATCTTCACCGTCCAGCATGTCATTT
GAGGAATCCAGCAGCAGCACGATCGGGCGAGTCGT