Description :
From Genome Similarity Track
Location :
Scaffold_70:84962- 86109
Transcript NameFunction/comments
g6131.t1OWZ16367.1 Glycoside hydrolase [Phytophthora megakarya

Sequence
1147 bases(100 bases per row)
CCAATTCATGCGATTGTATAGACAAGGTGACCTGAGCTTGACTTGTGATGCAGCTTCTTCTTTTTACCTAGACTGTGCTTTCAACAAATTTCAGGTTTGA
AAACAAATCCAAGGTTGAAGTTGGGCACCGTGGGTCACGCTTCGTGCACAAAGGCAAACTCCGAGAGATGCACCGGCATGACCGAGTAATGTGATGCTAA
CCTGCAGTATTCCAAAATAACGATTCCAGTCTTATTCTCACGTTCGGCGCAGCGCCTTGTCAAGTGTGAAAAAATATGCGAGGAGATGGTCGAGAATAAC
ACGGTGTCAAGAATCAAACAATATCGGAGCCTCAAGCCGACTCGATCACTTGCGGCGCTAGGATATTACGGCACTTTCCTCGCTAGATTACGCGTTGACT
CTTCAATCCCTTGTAGCGCATCTTTGCGCTTACCTGTCAGTAGCGGAGTTTACTTTTGTGGTACGGCGCGTAATACATGCTTCTAACAGTATACGAGATT
CACCAGTAGGTCGGTACGCTTTAGACGTCAGCCAATAGTGATTGAACTTTGCAATCGAAACACCAATTCAGTCGTACTGACTGGCGCCATAGACCCCAGC
ACTCCAACCGGAGCGAAACTACAACAATAAATCTGGTAGGCAAGTGTCTAGAAAAAAGATGTCCTCGCTCACTTTGAAACTTGCCTTCGATAGCACGAGC
TCAAGACTGATGAAACTCCTCGTCCTCGTCACTGCGCTGGCTGTCAGCTCTGCGAATAGTGCACTCGGCGTGTCGGGGCCATGGGATTCTTACATCCAAT
CGCCCACGTCTCGAGTTATATTTCCTGAGGATATCTACGGAAGTTCAGGCAACGTCACGCTCTCTGAGTCGAATTCGCTGGCAGCAACTCTCTCAGGCAA
CGGATCTACTGTCACGTTTGACTTCGGCCGCCAGATTTCGGGTGTGGTCACCGTACAATTCGGCGCTGCAACCACCAGCGGATCGCAGTTGGGTGTCGCC
TTCACTGAGAGCAAGCGCTACATCGGCATCACGTCGGACCGCGCTACCGGACCTTTGTTGGATGGAACGCTTTATGCCCCGGGCGAGCCTCGGTCCACCT
ACACCTTCGGTCGCGAATTCGGACGCGGTGGGTTCCGCTATCTGACG