Description :
From Genome Similarity Track
Location :
Scaffold_70:84952- 88740
Transcript NameFunction/comments
Phyci_94500calcineurin-like phosphoesterase, putative

Sequence
3788 bases(100 bases per row)
ATGGACACGGAGGGCTTCACGTCGCGCGCGTGGCTGGGGCACTGGGTCTCGGGCGAGGAGGAGCCCGTGAACAACTACTACGAGGACCACAAGCTCATGG
AGGGCGCGCTCATCAAGCTGGGCGACTACGCGCACTTCCGCTACTTCCTGCTGTTCCGCAACGGCCGCTTCTGCTACTACGAGCTGCCGATgcccgcggc
ggcgcccggcggcggtcccgaggggccgcggcgcgTGCACCTGACGCTCACGTCCAAGCACCTGCGCGGCGTCATGATGCTGAACGCGTCCGTGAACGCC
AAGGACCTGGCCAAGAGCGAGGACGAGTACGACGCCGACCTCATCAAGCGCGGGCTCGTGTTCAACCGCAAGAAGCTGGAGATGCAGCTCACGGGCTACT
CGCCCACGGGGCAGCTCATGTGCTGGAAGCTGCGCGCGGGCAAGGACGCCGTGTACCTCAAGTGGGAGCGCGCCTTCCGCCTCGCGCTGCGCCCCATCTG
GGTGCAGAACTCCAAGTGCTGCATGGTCTGCAAGAAGGAGTTCAGCTTCTTCATCCGCCCGCACCACTGCCGGTACGTGCGACGAGGCTCAGAGGCCCGG
GAGGAATAGCCATGGAGCTGCCTGGTTTGCAGGCGGTTACGCTGACGGACGGGTTGTGTTGACGCGCTGCTTTGTGTGTGTTTTTGGTGACGACCCGCAG
CAAGTGCGGCACGTGCATGTGCGACGAGTGCTCGGTGTTCGTGCCGAGGCTGCCTATGCAGGGCTACTACGACGAGGTGCGCATCTGCCGGGACTGCTCG
CCCATCAAGATCCAGAAGTCGTCCTTGAAGCTCGGCACGCGCGTGTTGGTGTACGGCATCCTGGTCGGCAGAGTCGTGCAGGTGGACGCTGCGGACGACT
CGGTGGACGGAAGCGCGTTCGTGAATGTGGAGCTGGTGAAAAAGGACAACCAGATGCAGAGATTTGCGCTGGAGCACGTGGAGCTGTACTCCGACGCGGT
GCTCTCAGCCAACCGCATCAAGAACGCGATCCGCCAGCACTTGTCGTACGCTGTCTTCAGGACACAGCTCAATTTCAACACATGGAACCTACTGGAGACA
GTTCAGGAGCAGCGCACAGTGCAGATGGTGCGAATACTCAACAAATCCACGAGTATCAACGAGTTGCACTCGATGGTGCCAATGCTTGGCTCATTGGACA
CAATGCAGTTCCCTGATGACGACGTCTCGGAGAAAGATCGCGTGAAGGAGTCTCTTTCGCACTATCGCGGCGTCCATGTTTCGTTCCCGTTGCGACTTGA
CACGGTGAAGAAGCTCATTAACCAGTTCCGTAACGGCATCTTGCTGCACCGCGTGTTTGTTCGCCAGATTTTGGACGAGTCCGAGAAGCTATTCCGAAAG
ATGCACGAGTCGCCGATGAATGACATTAAGATTCCCATGGGTGTGCAATTGGTTGTAGTGGGTGACCTTCACGGGCAGCTGGAAGATCTGCTAACAATCA
TGGACAAGAACGGCGTGCCTAGCAGCAAAACGTGGTATCTCTTCAACGGCGACTTTGTGGATCGCGGATCACACGGAATTGAGGTCATCTTGCTGTTGCT
AATATTCAAGCTTTTGTATCCCGATTTCGTGTTTCTGAACcgtggcaaccacgaagagcgtatgatcaacgaagttttcggttttgaagacgaagtgtat
accaagtatggcaCTGACAACGACGAGGTGGCCGGATGGAGTGGCCTGGGCACTTCGATCAATTACTCGCCGATGAAACTGTTCCAGATGTTCGAGACGG
TGTTTGGTCTCTTCCCGATTTTTTCGCTGCTTAACAAGCGTGTTTTCATTGTGCATGGTGGTTTGAGTAACCACGAAAATGTGACGATCGAGGAGCTTCT
CCAGCTCGACCACCGTCGTGAGATTCCTACGCAAGGCACGAGCCGTGCTGATGAGGTCTTCACGCATCTACTGTGGAGCGACCCGCGCGACGAAGACGGG
TGGAAACCGTCAAGTCGTGGAGCCGGAGTGGAGTTTGGCCCTGATATCACCAAGGCGTTTTGCGCACAAAACGGAATCAGCCTAATTATTCGGTCTCATG
AATGCAGAGAAGAAGGCTTCGACATCGTTCACGATGGTTTGCTTCTGACTGTGTTTTCAGCTTCAAGCTACTGCGGTTCCCAGACCAATAAGGGTGCATA
CGTCCAGCTGGAGTTGGGCGAAGACAACGAAGTGAAGCCGCACGTGGTGCAATTTTCTTCGCAGCCGCTTCAGAAACTGAAGGATGCTGGAAGGAATGAA
TGGCGGAAAAAAGCCCAGCGGTTGGAGCGCAGAACACTTATGTCTTTAGTGGAGATTATTTGCGAAAAGAAGAACGTGCTGCTGTCTGCTTTCAACGAGC
TGGATACAACAGGATCTGGACGCGTCACGAAACTCGAGTGGAAGGCAACTTTACAGAAGGTTTTGGGCATCCAGGCAAGCTTCCTCTCCTATTTCCATCA
ACTGGCTGAGGAAGATCAGCAAGGAGGCGTCGACTACCAGAAGTTCCTCAATCGATACACCGTTGAACTGGATGGAGGCAACGTGGAGTGGAGGCGGAAC
CTGATCCGGAAGGTCTGGATGGGATTCTGCCAAGCGTTACCTCGTCCTTCCGAAACGGACTCGGAGAAAATGACGCTACAGGACAAACTGCATTTTGCTT
TCAACCTCTTCCAGTCACCTCCGCCTGGAGCTGCCAAGAAGGAGCTGGTTACGAAACCTACCCCCAAATCTGGCGAGAATACCCAAGTGAACAGTACTTC
CTCCAATGGTGACAAGTCGCAGCCAAAGGAAAACTACCTGCGTAATGGGCTGGTCACGTACGAAGTGTTTCGTAGCACTATTCAAGGCAAACTGCAGCTA
GGCGATACGCTTTCAGAGCAGCAGATTTTCGAGCTGATGCAGCACCTGGACCAGAACCACGACGGTGTGGTGGATTATCAGGAGTTTTGCTCGTTCTTCG
CCGAGTTCAGCCGCGCAGATTACCTGCAGGAGCTGTTCGAGGTGGACGACACGAAGGCCATCTCGCTCCTGAACCGCTGCGCCACATTACTGCAGAATCC
CAACAAGTTCACGTCGTTGCGGGATGCGTTCGACGCGTTTGACCACAGTAAGACGGGGAAGCTGACCGTGGACGATATCTTGAAGGGGACGCAGGAGCTG
AACATGGTACCGGAGTTGAACAATGATGAAGCACAGCTGCTGTTCAACTCGATCTTGCTCAGCTACTACGGCATTAACCAGCGGCATCAGTGGGACACGA
GGGGCTTGGACTGGGTCGTGTTTGAGGACACTTTCTCGCCCGACAGCACCTTCCAGCGGCGGCTGTGGTTGGCGAGCCTCGGCGCGTCAAACACGAACCT
GGCTGCGTTAGACGTTCGTGACTCGCTGTCCGGGGACGACGACCAGGAAGGGCAGCCGTCGAAGAACCAGGCTTGGGCGGACACTTTCGTGGACAGCGTC
AAGCAGTCACTGCACGAGCAGCGACTGTACATCAAATTCCTGTTCCGGATACTGGACCGCAAGCGCCACGGGTACGTCACGAAGGAGCAGTTCGTCGCCA
CGATGCAGGCCATCAACGAGGAGCACGGCGCGCCACTGAAGTTGTCACAGCTGGAGCAGCTCGCCGACGCCTTCGCGCACCGTACGACCGTGCGTCGCAT
GTCGAACGCGGGCGAGGAGACGGAGGAGACGCGCACATACGTCTCGTACCCGGAGTTCCTGCGCAGCCTGCGCATCATCGACTCGGGG