Description :
From Genome Similarity Track
Location :
Scaffold_80:8494- 35948
Transcript NameFunction/comments
Phyta_totarag3101hypothetical protein PHYSODRAFT_551984
Phyta_totarag3102Mitochondrial Carrier (MC) Family
Phyta_totarag3103hypothetical protein PHYSODRAFT_353502
Phyta_totarag3104hypothetical protein
Phyta_totarag3105Mitochondrial/chloroplast ribosomal protein L13
Phyta_totarag3106hypothetical protein PHYSODRAFT_293850
Phyta_totarag3107hypothetical protein PHYSODRAFT_248380

Sequence
27454 bases(100 bases per row)
TTCAATGATTAACACTGCTTTATTGTTTCGATGAATGTGAAGCTACATGTGGTCAAAATGCGGTGAAGATGCCATGATAGAGTGTCTGGTGCGAAGACAT
CACTCCTAAGGATGAGCTCGTCCAAAACCTACTGAGCTGCCGGCTGCTGGGCGTTTGTTCGGGCCGCGTACATGGCGGAGTTCTGTTTGCGGATCGACTT
GATCTTCCGCTGCGAGATGAGCATGCCGATGGCAGTGGTCACCACGGTGAAAATAGTCGTCACAGCCGCGACAGCAATCCACGCCGTCGGGCTCAACCCC
ACGAAGACCTTGTCACCGCCGCTATCAACGCTAGTGGTCGCCGCAACACCGGCCGATGCGCCCGTGGGGATGACGGGGAAGATGTTGAGACCGCAGTTCA
CCTTGGAGTCCGCCACAAGCTTCATGAAGCCGCTAGCGCCCCACGAGCTGCCATACGAGTTTTTGAGGATCCAGTAGTCGCCCTCTGAGGCATCGGTGCC
GTAGcccacgagcagcagtgcGTGATTCACGTCGTCCTTCGAAGACAGGTCGCCGTCGTTCGGGCAGCTATAGACGCCACCGGCGTAGTCACCGAACGGG
TCCTCGGAGTTAATCGCGACAGCAATCGGCTGATTTTCCAACGCCGACCGCAGCAAGATCGTGCAGTTGCTAGAAGCCGTGCAGTCCGTACCCACAACCT
GTTCCCAACCCGTGATGCTGGCAGCCGTTTCATTGGAACTCACAGTGCACGCCGACGACGCGTTGTTAgaagacgtgctgctcgagccGGAGTCGTCGTA
TGGCATCGTGAGTTCCGTCACAAGACCCCACGAGTTCTGCGCAGCGTCGATAAAGGCGCCGTGGGTCATGCCACCATTGCAGCCATCGTTCTGGGACTCC
CACTTAATTTCCGTCTCCATCCACGTAGCGCCGTTCACGCCGCTGTCTGACGCCCAGCAGTAGTCGAAGgtctgcgtcgtctccagcgtACTGCACGTCA
AGAACTGCTGCGGTGAGAGCGACACCGCTGCCGACGCGTTTTCTGCGATCGCGACAGCCGTCTCGATAGCGTCGGCGGCAGCGAAAGCCCAGCAACTGCC
ACAGTTCTGCTGACTCTTGACTGACGAGCACACGCTGTAGCCGAACGAATTATCAGTGTCGCACCAGTTCCAGTACTCGGAGCTGCCAGCGCTCGACACT
GTGCTAGAGGCCGTCGCTGTGCTGCCACTGGCCTCCGAGACTAGCCGACGGGAGCGCGCCGACTTGACTTCCTGATCCACGAGCTGTTGGGGCGAGAGGC
GACGCCTAGGGGACAACATCAAGTGGCGCTCGTTCACGCCCATGTGGTACGAGAACTCATGGCCCACGCTCTTGGCGTACATGTGGACGTCCTCGATGTA
CGTCATGTGCGTCTGCAGGTTGCGGCTGTAGGCCTCCTGGTCTCTGAAGGACAGGAGGTTgcgctggacgagcagctcgcgcagtGTCTTCGAGGCGACG
ACCTCGCCGTTCTCGCCCGCCCAGAGGCATGGAGACTCGGCCGAGCGCACGACGGGGCAGTCCACTAGGGCACCAAGAGATCGGGGGGTGGTTCGCGCAG
CGGAGCCGACGGCGACGGCCGCGGAGAGCGCGAGGAGAGACCCTTGCACGTGCATGTCGAGGCTGTGATTCAGAGGGATAAGTATGAGACTGTAGCTGTC
TCTTTGGATTGTAAAAAAAACGTTTTATTCAAATTTGTTTTTATACCGTGCTGAGTCACACAGTGGTGACCAAAAAATCAAAACaggactacatgtacat
gtaggactccagcagcatccacGATCTGTGCTCGGCTTGTTGAGGCTACAAATTGTAGCTCGGTGACCTACACATGTAAGCCTACATATGTAGGTCATCA
ATCGAGCTATTACGCTTTCTTTAAAGGATGGCTGCTTCCAAGCCGTAGGTGAGACTCGCATCAGGATCCGATGCACTCCACCGGCGGAATTACCCTGCGC
TTCAACCTGTACACTTACCCCGAGGCGAAGTTGTAAATAGGCTTGGAAGCCTCATGCAACCATGCTGCCAGAAGCACGCGCTATCGACTGTTTTGTCGTC
CGACGGCTACAACTTTCTCCCACCGGGGTTTTCAATCAGCTTGGACCAAGATGATCGAAAACCGCGGAGGGCAAGATTATTGGTGCAGCTATTAATACCA
TCAGCTCGCTCAGCTGTTGCCCGCGAGCTGTGGTCTCACCGGATGCAAGCACACTTGAAATGGTTTCCTCTCTGTTGCCATCTTTGCAGTCGTGCTATTA
ATAAAAGTTGGGGCGCTTCAACCAAGCGACAGCGCAGCGAATGGCTATTAATAGCGAAGGCACACGTGCTCGCATTGCATACCAACGCAGCGTCCATGAC
GAACTTGTCGTCTCGGGTGAATTTGCGAACGTCGAGGATGAGTCCGGGCGTCCTTGCAAAGAGGCGATGAATCTCGCGCTGGTTGCAGCTGCCAAGACAT
GTGCATGTGTGCAACAAAGCCAAGCCGAtttcgctgctgtcgccgaCGGTGCTGGCCGTTAAACCGGGCGCGAATTTGCGCGAACAGATCATGATGCGCC
TCTCCTCGCCAGTAGGCGGTCCCTGACCACCTCAGCCACCGCTCCCCTCGATGATTTCGTCTGCGTCATTCCATTCTCGGATTCGCAGTCTCCTCGAGTG
TTCACGCCAATACAGAGCTCCCACCACCTTACACGACACTAcctgacgacgatggcgaccCAAACAggcgtgaaggaggaggcccCGCtccagatgaaga
cgacgatcgAGCCGCAGTGGACGCGCTTTCTCGCCGGTGGTGCGGCGTCAGCAACTGCCGAGCTCTTGACGCTGCCCATTGACATCACCAAGGTGCGGCT
GCAGGCGCAGCGTTCTGGTCCCACGACAGGCGGCAAACCGGCGGTGCACTACAATGGCATGGTCCATGCTGCGCAGACCATGATCAAGCAGGAAGGCCCC
GGTGCGCTCTGGAACGGAGCCACTCCCGCGCTGTTGCGCCAAGTCTCGTACACGAGCATCTGCATGGTGCTATACGAACCGCTGCGCAACATCTTCGGGG
CCAACGCGGCTCATGGTGCGAACGGTGAAGTGCCGTTCATCAACAAGTTCATGGCCGGAGGATGCGCCGGCGCCATCGGCATCAGCATCGCCAACCCGTA
CGTTGACAGCAGCCGCTGTCGTAGTTTTGACGGTGACTGACTGATGACTTGTGTCTCGTGTTGCTTTGACATTGTAGTGTGGATGTTATTAAGGTGCGAA
TGCAGGCGGATCGGTCGGGCAAGCTGTACCGTGGTGTTGGCGATGCCTTCAGCATGATCTACCAGCGTGAGGGTGTGCGCGGGTTCCTCCGTGGAATGCC
GCCCAACATTCAGCGCGGTTTTATCGTGAATGCTGCCGAGCTTGGCACGTATGACCACACCAAGGAGCTACTGATTTCGTCTGGGCTGCTCAAGGAGGGC
GTGCTCGCACATACTGGTGCTAGCTGCGTGGCAGGCTTCGCTGGTGCGGCCGCTTCCAATCCGTACGTGTATATTACCTGTTTCTACAGCATTCATTGCA
GTTTGGAACTGACCTTGCGCTTTGGATCGATATCTTCAGGATCGACGTGGTGAAGACTCGTCTTATGAGCCAGCCGACGGACGCGAGTGGCAAGGGGCTC
CATTACAAGGGCATGATGGACTGCGTGCGAAAGACTTTCCATGAGGGCGGTGCAAGCGCCTTCTACAAGGGCTTCATCCCGAACTGGATGCGGAAGGCGC
CTTGGtgtgtcgtcttcttcgtcacaTACGAGAAGTACCGCGCCACACTGGTgtccagcgacgaagagTTGTAGGCTTCGCTCGCCGAAAGAAGACTTcc
agcaagcgctgctggGTCGAAAGAGATTCCTTATATCGATGAAATGAAGCAACAAGATACAACCAACACATGATTGATCGTGTTTTCATCGCTTGTGTAT
TTTGAATGACCACTACTGCCACCGATCCCCCGCCGCCATCGCACGATGATAAATAAGAATACATTATCCTTTCTAATGAAGGCACAAGCGCGTTTCTCGC
GGGGGCAGGGCAGGGATGCCGGCCAGgaagcttcaacttcgcctCCTTCTGTCTGCATAAGCATGACGCCGATTCTCTCGTTCTTCGGCCACCACTACAC
TCATGGGTGACTCTCATACAAGCCATCTGGACCTCCTCCTTTTTCTTTTGTTTTTCAGTCATGGGGCGCTGGCCGTCGCGCATTATGTTCAGCACTTGAG
TTCATCAAAGTTGTGCATCTGTATGTACCACGTGGAGCGCGGCGGCGTGAGGTAGTGCATGGGTGCCGCTCCCGGCGGCAGATTCTCGaccagcttctcg
cgcagGTCAATGTACTCGTCTGTTTGCACCACTTTAATCTTCTCGTTGTCTGTGGGGATGGAGACCTTGCCGCTCTTGGGCAGCATCACGATGGGGAGAC
GCTCCACAACGCGGTCTTCCGTCGACCACCGGTTGCGCGAGATCACGTGCACGTTAAGGTTCGAGAAGGATCCGTTCATGAACCTGTTGGAGATGGTGCT
CTCGACGGAGGGCACGggggcctcctcctcctcttcctcttcggaGCAGTAGTAGGCCGGGCACGTGCGTCGACGCCGGGTGTTGTGGGCgttgttgttc
ttggcgAAAAGCGAGCGGCGGAAGCGGTCGCGCTCTTGTCGTCGGCTCTCGAGCATTTCTTCGCGCGACATGCGCTGCTGgttggtgctgtcgttgaCGG
GCATCACTTgggcgttgctgttgctgcctcctcccaggaagctgccgttgttgctgctgctgacactgCTGCGGCTGTTGCGGTTGagcgccttgagcag
cttctgcagcgccaggaacgtctcgtccacttcctcgtcctcagtGAAGAGGCTAGGgtcgtcctcctcggacATGCGACCGCCGATCTTCTTGGACAGT
CGCGTGTTTTGCCTCTCTGTCGTCGCCATGTTTGTCTCTGTCTGTCTCTGCCTGTGTGGGTGTCTCTGCTTACTCTGGGTCATGTAGCAAAAGTCGTTAT
GGACGGTGTGGTGGCGGGTGCCGTATTAGCGCAAGGGGCGGCTTCTAGCAACTACCACTCGCTCGCGTGTCTACGATTCGGTGATgttgacgctggagca
gcttctcgctTCCTGCCGTCTCTGTTTTCTCTTGTTGGACAGCGTGAGGCGAAATTGATTCTGCGACGCAATCGGATCGACCTCGACGTTTCAAAGACAT
GTGCGAGATACAATGTATCGATTTTCACGGGGATTCTGCTGTGATAGGTCGAAACTGTGCCTTCGATAATTTCGTTTCcgagaagctgtcgaagataGCC
GTTgggatgttgctgctgctgctgttgttgcgcTATTTTCTCGTTGTCGATTGCTTGATTTGGCTGccgttggtggcgttggGTGGGTGTCTTGCATGCC
AACGGCAGCCGCCTTTAGCTAGACTTGCGATGCTAACGTGCATCGCGCGCGCATCATGAATCATGATCAAGACGAAGATTGATTCAAGACGAAGGTGTCG
GTCAATTAGGACTAGGGTTGAAGCGTTTGTCAGCGTGGCACTGGCTGCCTCTGCTCTGACTCGGATGCGTCTGCATTGATTTGCTTGTAAAGCAGCGCGT
TGGTAACGAGCGCCGTCCAGGCAGACCGCTGTGCATGAGCGGCTCGTTGCCGTCGAAGCGGCCGGGCACCTCACTGCAGCTCAGTGCGTCAACGCTACGC
AGGATGATATCCTCGAGTAGAGTCGCTGGGTTGCGGCATTTGTCGATCCGTTCAGAGATCACTTACTACAgtacctgtacatgtactggaagGGGCTCGG
GCTGAGCCTCGGCCCGGAGGGGATGTCACACCAGATCGCAAgcgtttgcgcttgcgctcgcCTGGAAGTCCAACACAACGACGTCCGCAATCTCTCGCAG
CTCGCCCAACAGGCTTGCGACAAGCTCTTGACCATGGGCTCTTCTTCCAATAAAGTGCGAAAATGCTTTCTCATGTCCAGTAATCATTTTATGTGCGCCA
cccaacttcaacatccgCGCCCCTTGGGGACGGATCGCCGATCGCCGACCGATCGGTCCATCTAATTGACCGTCGCCGCTGcgatggcggagctgctgct
gcgctggatcaaccatgagctggagctgtcgatCCACGTGACAGACGTGGAGGCGGACTTCGCCAGCGGCTTCCTGCTGGGCGAGATCTTGCACCGTCtc
aaccaccagcacaacTTCTCCGACTTCatgcgcagctccagcgccgacgccaagATCCTCAACTTCTGCCTGCTGGAGCCCACGCTGCGTAACCTCAACA
TTAAATTCGACGCCAACGTGGCCACTGCCATCATGAATGAGAGGAAtgacgccgccgccaaccTGCTGTACCAGATCAAGGTCTCCTCTGTCCTGCAGAG
CCGTGCTGCAACGGaatatctacatgtactaacctgctgctgctctaaATAAACAGATTGCTGCTACTCGAGTGGGCAGAGCTCCAGGCGTTTCGACAAA
GTCGCTGGAGCGGACGGGTATCGTTCCTCTGCACAACAGACCCGTGAAGCTAACGAAGCCGACGTACGATGCAGAGAATTATCGGCTGTTTGAGCACTCT
ATTCGACGCCACGCGCGGTCGACTGCTTCATTGCAACAGGAAAAGTGGGTGTGCAGAAGTAACAATGCAGTCAGTTTTGTAAGACTTGACGATGACATGT
TCATGTTGCGGTTGCAGGGGCCGAATTGCGGAGGAAGCAAAGAAACGAGAGGCCTATCTGGCGAGGATGACGGAGCAGAGAGAGATTCTAGCGGCTACAA
AGGCGGAGAGACTGCATCGCGCCTACATTCATAGCAGCTTCATTAAGGAAGCACTCGAGGAGACGGACTCACCGACATGGAGGCTGGCATTACAGAAGAA
GAGTGCACGAGAACAGCGGCGGGCTGCATTTTTCCAGCAGCTTATGAAGAAGCGCGAAGAATCGGAGGTTGGTGTGCTGCGAGAAAATGGTTATCGTCTT
GCAAAAAATGCTGACAGCGCGTTAATTGAAATCATGTCAGGAAAATCTCACCTTCAGCCTGCGTCGAAAAGTGCGAAGTGATCTGGACGAGTTTGATGTG
CGTTATGACGGCGTGAGCTAGCTTTGCTCATTTTACTTTGTATGCACCGTGGGCTGACGAGAAGCGGTTTTCTTACAGGTTCAAGGTGGATCGAAGGTCA
CGGCTGCAAATGGCAAGGTTTCTTCGCGCAAGTCTGTTGGGTATGGTCTACGCTCGCTGATGACAGCACTCAATTCAACTTCCGACAAGAAAAAATATTC
GACTTCAAACTTGGCAGGATCACCAATGAATGAAAGGGAGCTCTATCATGCGAATGTGCTGGAAATGGAAAACACCACGGGTGTCATCGAGCAGGAAAGG
CAGGAGCGtgagaagcgcaaggagaATTTATCTCGCAGGAGGAAGCGATTCGTTCAAGAATGCGTCTACACCCACTCGCGAATAGGAACCGCTCGTGTAG
CAAGTATCTTGGAGAACGTGGTACTACGAGATACGAACAGCGAGAAGGATGTACAAGGCGAAATGAATCGCATTCTCATCTACAAGGAGGTAACTCGGGA
AAACAGATCAATGCGAAACCAAGAATATGTGAACCAGCAGGAATTGGACTCCATGGCAGCGGTAGACCGGGATACTAGCTGCTATCATAATTTGCTTCTT
CAATTTGAGGATGACAGCCAGATGCAGATTATACAACGAAACAACGTTCAGGAATCGGCTGAAGCGGTAGACCATTTTCTCAGCGAACAGATTTCAATGG
CTATCATGAATGATATGGTGGAATTCGTGCTTTTCATTGCTGGGAAGCGGGAAGAGACTCTGCATTCTCGAGACCCTGCCATTTTCTTGGCTGCGGAGAC
ATGGAGCGAGTACAAGGTTAAGTTTACTAATGGCTTCAAACGCGAAAAAATGTCCCCGCTGCCTGCCGTTGAAGAATCAAGTCACAATGAACTATTGGAT
ACTCACGAGCTGGAACAATACCTGGCGAGCTTCCGACCATTGCACACCACGTCTGAGCAACAACCTCCCTTGACAACGATCAACGCTGAATATCTTTTTC
TCGGGGCGACGGATGGCATTGAGGGATATTTCGTGCTCGGAGAAGAAATAAAATCATTGCGGTGGATCGCTCACTCGATGTCAATTTGCGACGCCATATC
GGAAAAAGACGAGCTTGGAGGAAGTACCATTGCTGGGGCAAATTTACCAGTTTTCCGTCAGCGAGCGTCGAGGTCCCTTCAGCAACTCCGAATTCTTGTC
TTTGGTCCTCCGTTTGCTGGAAAGGAGACCCAAGCGAAACTTCTTGGTGAAACATATAACCTGGTCGTGCTCTCGGTTCACGAGCTGATTGAGAATGCTG
TTCAGAAGTCTAATGAGATTGGCCAGCACGTGGAAAACCTATTAGTAAACGGAAAGGAAGTCCCCCCAGAGCTGTACAGCCGTCTTGTGGTCGAATCCAT
TGGGGAGATCGAGGCACAAGCACTTGCGCAAGAAAACAAAGCTGGCTGGGTGGTCTATGATCTGCCTGCAACAGAGCGACATAGCCAGAATCTAGAGGAG
CATCTTACGGACTATGTGGACCCGGCACGTATTCCTTCTCCCTACGAATTTGAGTCTGCCATTGCTCCGGGGTGCAGCAAGCCAACTTTGTCTCCGACAT
TCCTTCACGGTAAATCTGGTGTAGATCTCGTTTTCCATATCGACTGTCCTATTGGCACAATTCTAGACCGATGTTTAGGTAGAGTTGAGGATTGCGCGAC
AGGGGGCAAGCATCATTTGGTGTTCGATCCACCACTGGATGATTCGATTGCACGGCATCGTCTGCAACATGTCAACTCAAGCGCGTACTCAAGCGAACTC
CTGTCACTACACTGTTTGGCGAGCAATGGTTTTTCGCATGATCACAAGTCTTGGCATGCCAAATTCAAAACATTGCACGAGCCATCTAGCACCACCGGTA
TGACCATAAGCGAAGTTCATGACGCTATTACGAACGTTGTGAACCAGTTGCAGAAAGAGAGACAGGATGAGGTGGAGTCaaagcagcaccaacaagaGGC
AGGTGAGCAGATATTCATGGCGAGTGAGGACGAAAGACAAAGATCCCTGGACAATTTTGCATCGGAAATTGATGAGGCAAAGGTATGCGTGGCCAAAATT
GAGGCATCCGTGGTGGAGGCAGAGGAAGCAAAGGCAAAGAAAGAGGAGATTTTGGAGCTCCGGCAAAAGCTAGATGAGGCTCAACGTCAACTAGATAGTG
TCATGGTCGGTGTAAAGAGCTGGatagaagaagaaaaatcGCGTCGTCCTGTACCCAGCAGTAAATATTCGGGCGAGCTCGTACCAGCAACAGCCCAAGC
ACTGACAGCATTGTGGAATGACATGGAAGTGGAGTACATTTCTACCATGAAGACAAGTTTTGCATTAATGCGGAATCAGCGGCACCGCATTACTGAGCGC
GCGCAGATAATGACGAGCGAGTTTTGTGAGTTTATACGACGTCCCGACCTGAAGCAAGAAGTTGTTAATGTATTTCAAAGGCAATTCAACGAGGTGCTTG
ACGAGATGCGCTTTGACGACCTGACAAAGCTCGAATTGCATGCTCGCACAGATATGCTGCAAGATGAACTGGGTTCTCTCATCGAGGCTAAAGTCGCcga
gaacgacgaggagctcagtAGTATGGTCGGTGGCGATTGGACAGAAGATGTATGCCAGCATGCCGCTGCTATTTACCAAATGGCACTTCAGGCGGAATGT
GATCGCTTCCGAATCtccgttcagcttcttgtaaGCGGTCACTACGCTGCAAGTAGTGATCGCTCTCAACTGAAAAGTATCGTGGAGATTTGGCAGTCAC
ATCAGTCTCGGTTGGAATTGGCATGCAGAATTTATCGTGACCCGGCGAATGACACCCCAGTAGAAACTCCGGCAGTACCCGCTGCAGCAGGGAAAACTGC
CCCGAAGGGAAAAGCGAAAGCATCCGTACCCGTCGTTGTGTCTCCAGTCAGTGCGGCTGCATCTAGCGAAGATGCCCTGGCAGAGTCGCTGACTATGACT
GAGCTGCTAGCAGAGTACGCACATGTCTTACAGCGATGTGGGTCATGGATGGAAGCCATTGCTCCAATTGCCAAGGCAGCAACTGAAAAAGCTGCCGAAG
GAGATGACTTTGCAAACCGAAAACCCGAGGGTGATTTTTGTTTGGTGAACTTGCTGACCGGGATCAAATATGAGCACGACCTAATGGAACGACGAGTACG
GTTCCTACAAGAAGCCACCGAGAAATGTTGTGATGAAATCACGCGGTCAATGCGCTCCATCGAGATCACGTTGCGAGATGTTCTAGAGGATCGAAAAGAT
CGAGAGCacgtggctgtggctgcagTGATCGAATATGCCCGTGGCGCTATTGAGGCTGAAGTCGCACTTCCGTCCTTTGTTGATGTCAGCGTAGGTGTTA
TCTCTCTTGCTTTCTTGAGTTTGTTTTGCACAATCTAACCGTTTTGTTGCACTGCAGCCTGAATTCGTCGAACGGTTTCCAACAACACAGCAATTGCGTG
AAGATACAATGGTACGCGTCGATGGAGGTAGACGCTTGTTGCCACGCACTCCTCCACATACGACGCTTATTGTTGAAGAAACGCACGAGTTGCTTCTCAA
TGCTCGTCAACGCGACTGTCTTCATGAGGCTTTAATCTCGCAGACTGTCGACAACTCTGGACTACTTCCCCTCATCTCGTTAGTTGAGACGATAACAGCT
TTGACATCGCTACCCGACGCGCTTCCAGACGTCTGGCGTCGATGCCCCGCACACGTCGTCGCAGAGGTAAGACCCATATCGTAGATTATAACCGTCCCTG
TCCTTCTAACCTTGTGGTTTCTGCTCGACAGACCGCCGCAGGTTTCACGGTGAAGCAGTCAGCGTTCGTCGACATCGAAGCTCTGCTCACTGCAATGAGC
ACCCGCGAAGACCTACTCCGTCAGTTCCAAGAAGGCGAGGCCAGAGAACACCAACGCGAACtacagcgccaagaagaagatcaagagcGCGAACGCCTtc
tactgcagcaacaagagagCGAAGATAGCGAACCTGCACCCGCAGACGCAGTAGAATAATAACCACAAAGAGGCTGTTGCAGGTAAACAAAACAGTCGTG
TCTTCggcttctccttcctctcTGTGCCTGTCTCTATATCGCCTCCCTACAAGATGACGGGGTTCTCGCCCACCTCATTGACGAAGTCGTGCGTCTCGTC
CATGAAaatcttgagcttcttgtcctgcagGGCGCGCATGCGGTTGCGAGGCAGCATACCGAACACAGCCTtgcgcagcacctcctcgGGCTTGCGCTCG
AACAGCTCCTTGGCCGTGCGCTGCTTGAGGCCGCCTGGGTGGCCCGTGTGCCAGCGGTATAACTTATTGTTCCACTTGTTGCCCGTGAGCACGATGTCCT
TGGCGttgatcaccaccacgtaGTCGCCGCAGTCCACGTTGGGGGCGTACGTGGGCTTGTGCTTGCCGCGCAGAATGGGCGCCAGCTGCGACGCCAGACG
CCCCAGCACCTGGCCCTTCGCATCCACCACGTGCCACGCCACCTTGGAGGCCTGCGCGATCTTGCTCATGATTGCTACAGACAGCCACGCCCACTCAGCA
AGACCCACAAGCACTTGCTACCTTCCTGACCGCAGAAAAATGCTTCGAATTGAGGCCACCCGTCACAGTGGTAACAAAACGGTATAACCGACTCAAAACC
GGTTTTTAACGATAATATATTACCGCCCGTTTGTCTTAATAATACATGAATTAATACCTAATAACGCATTGTCTTTCAAAATGGGTCGCTACACGACGAT
GCAGACGTTCAGCGACCAGGACGCGCAGGGCGCCGCCGTTCCTTACGAGGCGACAGCCACGTCTTCAGAATCttctgtagctgctgctgcgcctaCCGCC
AACGACTCGAAGGACGCCAGACTCCACATCAACCGCGTGGACAACGTGTCCGGCAGCTCCGCGGGCGCCGGTAGCGGCGACTTCCACACGTACCGCGCCG
CTAGGAGACGGTACGACGGCAGAACCTGTTGACTATATAACATACTATCATGCTAATGCATTAGTTTTGTTGATATTTTGCCAGAGAGATGGAGCGCgtg
gcgacgatggagcagcgCTACAAGGAAAACAAGGCGCAGCAGGACTTCGAGGCCACGCGCAAGCGCAACACCGAGGAGTTCGAGGCCAAGGTGCAGAAGC
GCGCGGAgaagcgacgacgacgcaagGAACGGGCCAAAGCGAAGGCTCTGGATggagttcaagaagaagtgaagggggagaaggaggaggaagagaagaa
gaaggatagtgcagacaagaaggagcaaGTGCCTGAAACACCGGGCGGCGTGGCGGAGATTCCTAATgatggcagcttcttggaGAGGATGCTGGCcttg
cagaagcagaaggacaAGATTGAGAAGAAATGAAGTGAGCTCTGGACGGGTGTAGAGACTTTGAGCTGAGACCCGGTTGGGAAAAAAAAAATTCGGGGTA
TTCATTCATTTGGTACCTACCGGTACATGCatctttctccttctcttctcGTTGCTAACGGATGTTGGCACGTAGTACATACAAGAGCGATCGACAGCTA
CTAGTTGTCATCCTGGAAGATCAATGCAACGCCACGTAACACCCACTTGGAGCTGCCACAGTCGgtcggcagcgtcgccaaGAAAATGTACGTGTGACCA
CGGAAACGTGTGAGGTAAACCGGACACTCGTAGATGTTCGGGTCATGACGCAGGTAGCCTACAGAAGAAGGTTCCCATGTTGGTGATGTGGTCACGGCCT
TGACGTAGATGACAGGCATACTCCAGAGCAACTCCTTGGGATTACTATCCAGCAGTGTGCCGCCGCACTCCGTAGGTGGCGTCGCACCAACCAGATAACG
TtcgttgatctcgtccagtGTGCCCCATCGCGCACCTTCGAGGATAAGGCCGTGCACGAACACACCATCGTCCGGGTAGTTTGAGATGGTTGAAGAGTCT
TGGATTGTCGTCACGTGGGTCTCCACGGTCATCTGGTTAAGCGGCATGAATCGCTTACGAGACGTGACCTGCAGGCACGCCGTCGTGTAGGCTGTGGGGT
TGAACAGTCCCGGTAGCCAAATAGAGAACGGGGTGACGAAGCAGCTTCCGCCTCCACCAGTGGTGTCACCAGCCCACATGACAAGCTGCTCATGGCGTTT
CACCATGTCAGCGAACCAGCCACTTAGCGACTTCGTTGACGGCCAAGCCTTCTTCTCCCATTTACACTGCGAGAATGGGTTGCGTCCAGGCACCTCATTC
AGCGACATCGCTGTGGCCAAGTCCTCCATTGCTTGTGACATATTGAGTTGTCCGTTGAGGCCCTTCTTCAGATCTCCAAGCGATAAACGGATCTCCTGTA
GTAGCACGTTCATGCGGCTGCATTCCTGTagtgccaccaccacgaaggGGCCGTGTTCCTCTATCAAATGCGGTGTTGCAGCCTCCACCACATCTAGCAT
GTTAAAGAACCCTGGACAGCGTGTTTCCAAATCGTCGATGGATGCACGCAGTACTGCTGTCTTgtcaccgcctcctccttcctctccacctccaccagca
cctccgccGATAGTCACGATCGTGTAACATAGCGTTTCACACGTCGTGGTGAGGTAGCCGATTTCCGCATTCGGGTGAAGCCCGAAGAGCGGTGGTGCCT
CAGGAACCATGTTCTTCTCAATGTAGTTAGCGTAGTCTGCGAACGAGAACTCTTGTGGATTAGGCGACTTGAAACCAGGACCGAGTTCCATCCCATTGAG
TAGTCCTGGGTCGATGAGAACAGTCAGGTACGTGTTGTTTGTACGACGATCCCAAGCGTCAGTAATATGTCCACCATACATGATTTCGCCAAACAGATAG
CGCAGATCATCCCATGGAACTAACGCGTTGTTGTCCAGGTACGAATGCAGAATGTTGGCACAAATAGTGAGATCGCccgtgttgaagctgtaggCACGAC
TCCAACCCTGCTGACCAAATCGCCGTCGTCCCAACACAATTGCGTGAAACCAGCACAAAGAGAACAGACAAGCCTTGAACTCGGCCGGTTTCGTGCAGGC
CTGCACCTTGTCTTCACCGAAGTTTGCCCAAGCACGTCGTAGGTTTGACTGAATATCCGAAGGTGCCTCGTTCGCCACCTTAATACAGCTCTGAAGCAGC
GACTCAGGAATGTTCAGCATGTCAGGGAGTGGAGGCGGTTCAGCCGAGATAAAGCATCGGAAGAGATCATGTGCACCTTCCGTTGTAACCTCTTCCAGCT
GACGCTCTAGAGTCGGCAACCACGATTGCATCAAGTGGACATTCTGCAAGATGATCCAGCCACCCTCTGTGCTCAGTCGCTTCAGTGCTTCGCCTGCGTA
TGCCTCCTGACCCTGACCCATGGAAATATTGATGAAGTTGTTGTTCTCGAGACTTACACCATTTGATCTGCCGAGTGTTTCTACCCATGGTGTCGGATCC
ACACCAGGGAACAGCACGAAAAAGATCGGAATGCTCGAGTTTGTCTCGGCGTACGTGGCCTCCATGTTAAACGGTGGCTGGGTAACGTACTCCTCGCCCA
ACGACTCGAGGATGAATGTACGCAATGCATTGGTCACACGATCTGGCCGCATAGCACGCAGCAGTATTAGTCGCTGGAAAGCTGTAAGCTTCACGAAATC
CCCAGGAATCTTTTGGCGCTCGGCATCCTCGGTAGCAAACCACTTTCGCCACTCATCAGGGTCATTTTGAATCGCATCGCCAAGGCCTTGGAATGCCTTT
GAGCTCTCGAGTGACTTTAACTTTGCCCAGATGGCTGCGGGGAGCCACTCGGAGGCTGACCCAGCATTGCCTGCATCTGGGTGGGCCTTGCTGGTAAGAA
AACACTCGACCTCTGTATCGTGCAATAAACCATCCTTCAGCAAGATCTTCAGACACAGCATTGTTGCTACTGTCAGCTTGTTGCGCTCAAACAACCCGCG
GCGAACGTAGTTGTACACACAGGAAGTGATGCTATCCATAAGCACCTGACAGCGTTCTCGCATCTCTTCATCTGTCAGGTCCGCGACGGCAGGTTCACtg
tcttcattttcttcatcaccacctccttcaccactTTCCCCGCCTTCTGTAGCTGGTGCAGCCACAACATCAGCTGCAGGGgcagcgtctccttcgcCAC
CTGCACCATCAGGCTCGTTAGCAAGGAGATTCTTCGCTGGCGGTGCGCGATAGATGCCCGACAAGAAGACTTGCTGGAAGGACGCGAGCGAGTAGATGTA
GTACGAGTGCACCTTGCTGATGTCGTTCATcaggaagaacagcagcgaaCCTCGTGCGGCAATGCTGCGGTACTTTTCACTAGTGATGTTCACGGATTCT
TGCGTTTTCTTAGCGGCCTCCATGTTGTTTTGCGTGCGCTGCGCCTTGTGCTTTGTGTCACTCAGAATTTGAATTAGAGGCTGGTTGTTCGTGATATCGT
CGTCGGCACTTGCCAAGTAGAACAGGATATCATCCTCCAGCTTTTTCAGCTCGATCTTGCCGTTGTTCTGCTCCTGAATCAGCTTTTCACGCTTAATGGC
CAAGTCTTGGCGCTCTTTGGACACAACAAGGTTCAGCAACTGGTCTTCGAGACCGAGCATCGTGACAGTAAAGTTCACGATCGTACATTCTGCTTGAATC
TCAGGCGGGTAGTGAGGGTTGCTCAGCTTCGTGTGCAAGTACAGGTGAAAGTTGTCGTTATACGGGACGGAGGCATCACCAATTTGAATTTCGTACCGCG
CACCGCGACGCGATGTTGACCGTTGAATGACAGGGGCCAGGATAGGATCAATCTTCTCACCAAGGTTCTCGATCAGGAAGGCACCATCAGTACCTATAGC
CGTTTTGAGGCGTTCAATCCACATCTTCTGCCCCACTCGTACAATGATAAGATTATTGTGCGCCTCCATCTCACGGATCCACGCAATAGCTTGCAGTTGC
GGATCGACGATAAGCGGTCGTCGTCCCATAGATACCGTCGTCACCACAATGGCGCCGTTCTCTGTTGACACGCGGTCCGAGGGGAGCTTCTGCGTATTCC
ACTCAGCGATCTGCGCGTCGTTTGTCAGAATGAGTAGTGGGTTGGCTTCTTCGGACATAGCGATGCTTTCGCCGTCGGCAGCAGTTCGAAGGTATGGCAC
CCAATGCTTGTTGATAAGTTCATCGCGGAACGGCTTCGTGAACGGACCAATGTATGAGATGAAGGCTgaagcgagcagcacatCGCCCACCAGCAAGTCC
TTTTCcttctgaagctgcagaacgTTGATACCCCATCGTACATTCTCGCTTGATAGATCATTAGTCAGCGTGCCTGCAAGCTTCATCTTGCGGTTTCCGG
TCTCGACAGCGTTAATTGCATCTTCTTTCTCCttttctgctgcagcggcttctgccagcagcttgtccagcttTGCTTGCAGATCAGCCACAAGTGCCGT
CACTTCGCTGAGACGGGCGTTTGCAGCCTCGAGCTCTAGGTTAGCAGCGGCCAGGGCCTGTCGCTTAGGCTCGACCGTAATGACGATATCGTAGTACATG
ACAATGTTGATGACCCAGGAACACAAACCGGCAGCGGCCTTATTCTTCGTGAGGATCGTGTCGTAGTTGAagtgctccatctccaagaACACACGCACCT
CTTTCCAGTTAGTGAGAGGTACCTTGCCATCGTCGACCACTTGCTTAAAGCCAACCAAGTACTCGATGTACTCTGGAATGTTACCTAGTAGCTGCTTTTT
GGCGGTGTCCCATTTGACGTCCTTCACCTTACCGGTCTTGGTGACCTGTACGTTCGGGTGCACTCCAGCTAACAACACCATCGTAGCTGAAAAGACGtcg
tcaacaccagcagGAGGCTTGGACATCGTCTTACATTCGCCCAGATCTTTCTTGTTCAACGAGTCAAGTGCTGCCATAGCCTGTTCCACAGCAGGCTCAG
CCTTTGCGAGATCCTCCTGCGTTGAACGTTGCTTCTCCGTAACCTCCGTCTGGATGATGGCACACTTTGCGGCTTCGTCGCCAGCCTTCTTACTTTCCGT
TTCCACattcgccttctccttgttcACAGCCTCAGCAATACCAGATGCAACTGCTTTCTTGTCCTCAGCGGCTTCGAGAATGACCTTGAGTTCTACTTCA
AGGCGCGACACAGTGTCACCAGTCTCCTTGAGCTTTTGCAACCCCTTCTCTAAGCGATCAATGGCGGCAGCAtactcctccaccttcttaCGCAGAATCT
TCTTGTACAGTTGAAGCAACTCCAAGTACGACTTGGGTGTTGTGTACACGTGCCGACGCTCGACCTGGAAGAACCGCTCAGCGCAGATATTCACCGACTG
GAATGAGAACGGCATAAACTTCTCGATACCTGCTCGTGACTCATCCGACCCGAGCAAATCTCCAATCTCTTTAAGCTTCTCCCGACCGACAGAGAGCAGA
GCTTCCTTGGGCCACGGCTGGAACCAATCGATAACTGTGCAATTCACAAGTGCAGGGAACTTGCGAGCACGGTTACGGAAGTCGTCACCAACAGGTGAAA
AGCATAGACACAGGTGGAGCCGCTTGCGAATCTCAGCTTGGAAGAACTTGATTACCTCTTTTCGGTCCTTCGTGCCAGCTACAGGTGACAGTAAGTTGAC
GATGTTGTCCATATCTTCCATCGCGAATAGATCTGGAATTTCACCCGAGGCCAGCAGATCGTTCAAGTAGATCAGGAACTTCTCGTTAGTAATTTGCGAA
TCCGTTAGCATGAACACGactcctccatcttcttcgttgcgAGACAGCATCTCTACTACGGCCATGTGCATCTTGCGCAAGTCTTCCTTGAATTCATTCT
CACCATACTTGGAACTGATCGTAATCTGACGCACAGTGTTGCCGCAGATGTGCGAGGCCAAACGCGCCAGCGATCGCTTACCGCTACCTCCCACACCAAC
CAGCAGTGCATGACCACTCTCATTACGCAGAATGCGGACTATACGAGCCACGTGTTTCACAGCATCGTCGAATAGATCCAACTGCATTGCAGTGTTGTTT
TCATTGTTGTTGTAATCACGGAGCTGGACTTGCAAATTCATCTTGAGATCGTCCAGATTTGTTCCCATGATCTGGTCATACTCGTTATCGCCATCTTTTG
TGAAGTGACAGAAAATGAGGGGCCATGAGTTCTCAGCAGCGTAGTATCGACTCGTATTGCATGACGCAAACGACTTTTTCACTTGCATCTGCACAAGTTG
GTTGTATTTCTCGATATCAGCCTTGCACACAAGTCGGTCACCATACACGCGTTCGCTCTCGtgcaaccacagcaacacgaaTTTCTCCGTGCTGTTAAAA
CGATCCTTCTTCGACGCAATGAGCCCTTGGAAGACATTGGACAGGTGGCGCACATTGAATTCGTAGTGGaaatttgctgcagtctttCGGAACGTGCTCA
CAACACTGGCATGCAGACTCAGTGCCGCCTTGATAAGCGCATTGGAGAACTGCGAGTTACTCAATTCATCAGCGAATCCTGACAGGTGACCACCGAGGAA
CGTCTCATAAATTGTGACCAGGCTTGGTGCTTCAGGCATGCCCATAGCAAATGTACAGAAGTGACGCTGAAGGCGTGGATCAACTAGGAAGGAACCTGCA
GTGGGGTTCATACCAGAGACCACCTGCGTGTTCAAAATATTCTGCGGCTGAAGCTTCACACGGTCAAACCAATGCTTGTACTCCATCACCTGCCGCAACA
GGGAGATAGCGCTCTGAGTGTTGTAGGGGTCCACCTCCGGCAGGTTCAAATCGTCCATAAAATAGATGAGTCGTGCCTTGCCTGGAGGGCCAAGATTGAT
ACCAGTTTTACGCTCCAGTTGTCCGAACATGGTCTGCTGCAAGATGGCACTCGTGGTGTAGAAGTTGAAATTGATGGTGCAGTAGCGGAATGCAGCCGTA
GCCTCATCCTTGCTGAGCTTTTTCAGCATACCCATGATATTCTGCGTCTTACCCGTACCTGCGGGTCCACACACCATCACCGGCACATTCTTCGAGATCA
GGTTCTCAAGCCAGAACGCAATAGACGCCGTCTCGGTTGTTGGCACAGTGATTTGATTAATCGGACTAGGGGACACGTAAGTCTCGGTGTAGAAGTATGG
ACTCTTGGACCATGAGTTGAACTTGGAAGTCTCCGGGTCCAGCCAGAAATCAAACACCGTATTGCTTGCAGAAGCCACCAGCTTTACATCCTTCCACTGG
TTCTTCCACCAGTTGCTAAACTCTGCTGAATAGTCCGTACCATCATCGCTCATCGTCAGGATGGAGCCAAAGGACCACACGCAGCAGAATACAAACGTAT
TTTGCATCACTGTGTAATCTTCCAGTACTTGAGGAGTCAACAGACAGTCAATCATATTCAGCAAGTTTGTCACCAGAGTCGTCTCCTCCACAGGGACAAC
GGGGACAAGTTTTTTGCGGAAGAACCTGAGCGTCGTCTCGATATACTGATCAAAAAGCCCTTGGAACTTGGTGCGCGTGTCCGGAGTGAACATCATGTTT
CTCAAACGGTGGTCCACAGGCTGTTGGCAGTGACGATCGAGCCAACTGTCGATCAAGCAGCGCCATTGGTACCCCTCCGATGTAGAAATGTACAGAATAC
CAGCTCGTGACACGGTTGCCGGCGTGGCGTAGACAAGATCACGAATCTCAAAGATCATGCGCATGTGAACTTTCAGCGGGATACGCTCGTTTGAGGCCAG
AGTAAGCATTCTGTTATCGTCCATGACTGAGTTCATAGACTCGATCCAGTTAGCATCGAGATCTCCGTCCAGAATAATCCACTTAGGGTTGTTATCTTCG
TCACCATTATCACGGCGCCGTGAGCCCAGATCCCGCATGATGCGCGAAAGTAAACCATCCTTCCACTCACGCGTCTTCAACACGATGTACCCGTACAGTT
CGTTTGTGCTCACCGACTTGGGGTTCAAGTCTTGCACTTCCATCGGTGTGCCCATAATTTCGCGAGCCTTTCTTAGGGTTTTCCATGTCTCCGTTTTACC
AGAGGCAGGCGGCCCCATGACAAAAACACAGTGTCGAATTGCCAACAACTCAGACAATTGCACAACCTTTAGCATAAATTCCGGGCGGGGTGTGTTACCG
ATTGCTTCCGAAGCACCCTGTACCATGGACTCAAGCTCCATATCACGCTTACGTGGCGGATCATTTCGTACGTCCACATTCGGGCTGTCACGCGGAAACA
GATCTCCGAGAAGACCGAAGAAGACCACCATATCCTCTGCGACGATTTTCGGGATGTTAAAGTCTCGCAATGCACGCATAAGCAAATCGGTCTCAGGAAT
GTCCGGCTCGGCACGCTTGAACGCACCAGCGACACACAACACACTCTTTACAGCTCGAAGTCCCCAATCGTAATGCAGCTGTTTGGACAGGAGCTGCCCA
AGCAATGAATACAAGCCGTAGAACTTAGATGCTAGAATCTTGGCTTGAGTGAATCCTTCTGCCATTAGCATGTTCTCGCAAATCAGCACCAGATCGGGCA
CCATGACGGTCATGGGGCGGAACAACGCTTTTAGACCTTCAGGCAACTCAGAGCGTCCTAGATAACCAGGATTCATAGTGATGAATGCACCAACTGTCGG
GTCCAACATCACCTCGTCATTCTCAAGGATAAATTTCTCATCATCAGCTTTGCATGCGTCGCACACAGCCTTAAATTGGACGGAACACACCGACAACACC
TCCGGTACCAAGCgattgaactcgtcgaaACAGCCCCACGAACCGGACGACGCAAGTCCTTTGAAAATATTCCCTAAACTCTTGAAGTCCATTTCAGGGG
AGCAGTTAAACACGTAGCACACTTTTCCCAGTGCGTTGGCCAAATCCTTGGTCGTCTCGGTCTTGCCCGTACCAGCGGGACCAGCAGGAGCACACCCCAT
CTGCAGGTTCAATGCTTGTGTTGCCGTCACGTAGATTCGATCCGTCAGTGGGGTAATCACAAGTCGAGGACCATTTCCGAGATATTCGTAGTCGTACGGA
ATACCAGCGTCACAGATCAGAATCTGAGCGCGCGCATTGTTTGCTCCACGGAAGGTGCTATCACGTTTTAGGAAACTTCCAGTTGCTGGTGAGAAGTAGT
GCTTCAGTTGAGACTGCCATTGGAAATGTGTTGCCTCCTccacaccagcacgaatCATATTTGCCACGATATCTCGACCGTGAGCATCCATTGTAATGAG
CACCATCACGCGCTGTCGCTCCGCGTACGAAATATTACTTTGCGTGAGCTTGATCAAGTCTTCtagctgcttctcctgcaaCGTGTTGTAGTTTTTCAGA
GCGTCTTTATCACCACCTTGAATGCTACGGAACGCACGCTCGATTTCTTGAACATAATGCACACCTGCTGCAAGCAAGATGATCTGGGCTGCATCCATGG
GTTTGTTGGTGTCGTCTTTGAAGTTGATCCAATCAACGCGAGGCATTTCAGTGTATGCTACAAGTGATCGCTCGATATGCTTGAACAACGTCAGCCTCAT
AGCACGCATAATAGTCGCGAGGTAAATCTCTGCCTCTCCTTCCAATATCGGAGGCTCGAAGAAATCAACAATTTCGTGACCCACTCCAGCCACAAAAGAC
GTGGCAACTGGTCGTTCTCCATGTCCACGGTCCACCAGTGTGAGCGTCTTCGTTGCCAAGTAGATTTTGGAGCAGTGCGGCATGATCCGATCGGGGTGGG
ATCCGTTTGACAGAATATCCAACAGATCTGCTTCGGACATGAAGTAAAAACGCGGAAACTGGCGGCGCCGCCCGTCCAGAAACTCTTTGAGACGGTGTTT
GCACAGCTCGAGTTTTTCCACGATAAGCTCCAGTCGTTTGATGAGACCTGGCTCCGTACACGCTTCCTGGACGTTAAGCGTTTTCCATGCTGTCTGTAGA
ATTTTGCGAACCTCCCTGTCGATATCTTCGAAGTCAGACGTTAACTCGGGCAATTGTTTCTTCACTTCTTCGGACTGGATGAACAACGGTTCTAAGTAAC
TCCAAGACCGCTGAATGTCACCTAAGAGCAGTGCGACTTCATTGATGGACGAAAGGCCGATTTGAAGTTTTGCAACGCGAGGTTCAAACTCGGACTGGTA
CGGCGACGCACTCATACCTTGCACGTCGATTTGGTGCGTCTCAAGGAGTTCAAAGTTTTCTTCTGACACCTTGAGTAGAGGCACCATTTCGTCTTCTGGA
GCGCCTAGGTTGTATGCGTTCATTTCCCAGTTCACCTCAGCCCACAGTGCCTCGAGCTCAATCAACCGTAGTTCGAGCTCTTGTTCCTTCTCTGCTTCGT
AGCAAATCTCATTAATGTCAGAACTGAAGTTGAACAGATTTTTGCTCAGGATCAAAGACAGTCGCTGCTCCGGGTTTTCGTCCGGTGTCGGGAACTCTCC
TGTGTGGGCCATGATACGCTTCCAGTGTCGTGGGCGCATGTAACTAGATGACACGCACCGAATGAGCGGGTGTGTCTTATCAAACGCCTGACACTCCGTC
AAGATTGAAGTATACGCATCGCTCCATTGGATACCTTTGGGGATCTTCTTCAGTTCTTTCAACGCAGATTGCACTTCAATCTGCAGCGCGTTCACATCCA
CCTCTTTGAACAAAAGGTCCTGAGTCACCGCGAAAAAAGCTTTCGCACGCTTAATGATCGCCCAGACAGTCTTCATCGCATCCGCATCCGCACGTATTAG
GCCCATCATGTGAAGTGATTCATTCATAAGTTGTGGGAACCCGAAGGTGGAGCACAACTTCGTGTTTTCCTCGCACTTCTTCATTTCCATGTTCCAATCG
ACGAGGTAATTCTCAATCTTCTCCAGACCCTTGTCAGGATCCAGCTTAGACGACCAGAAGTCGAGAGTCTTGAGAGTCTCCATCTTTTGCGCGATCATCT
TCTCGTACGCGACGATCTTCTCCTCGGTCTTCTCACTGAATATCCGCGTAGGCTCCTGGGTGCGCTTCTCGGTGACTGGAACTTGCTTTTCGACATCTAC
GAAAAGCTTCTCCATGCTCTCGATTTCCACTAGCTCTTTATCGACATGACCGCCACTATTCTTGATATTGAAGAAAAGCTGCCGCACTTGGTCAAGGATC
AAATGGTTTGTCCCTTTATCTGTCTCCAGCTTCCGGATGAtttccttcatcttccgcAGTGTTTCGAGTCCATCTGTATCGTTATTCGGGATGTCCTTCC
GCAGATCAACGAGGATACGCCGGAATTCTCCGTTTCGTTTGTTCATCGTTGCCATCACACGCCGAATAAGCTCTGGCGAGTCAAAGTCCTTCTGGGATGC
AAGCGGTGGTAAGCACTTCGTTTTGTTATCATCTGTAGCAGGCTGGAAAACTGCGGTAAATGGTGAACCGCGAATAGGCCCTGCGACCCCATTAAACGTG
CCCGTGAAATCCACCGAGACCTCGTATTTGCCTGCTCTGAGTGGTGTAAATGTCACCACGTACGTGCCGTCGTTCTTGTCGAGGATGGATGCAACTTGGT
CCACTTCGGCCTGAGCGTCGTCGCAATACTTCAGAGCAATAGTGAACTCATCTCCTCCGCAGTCTCGAGGATTGTCGTCCTTGTCCCGAGACTGAATGAT
AAATGTAGTTGGCAGCTCGGCCAAACAGTTATCGCTAAGTGCAGCGATTAGACACGGTCCAAAGGCCAGCGActttggagctgctgtgaCCGAGTGAAAA
CGGAAAGATGTAGCAACGTTCGTGTACATACCACCAGATAATGACACTCGAATTTCGGCAGCTAATGCCCCGAATTTCTCGAAGCTGGGGGCGGTTGCCT
GGAGAACAGTTGGGCTAAGGACAGCCCCCGTGACATCGACTGACCCTTTAGCAACCGCAAAACGCAGCGTAGCATTTTGGCctgtgaagttgaagcccGT
GACTTTCACCTTCGCACTTCCCGTGATTGGTCCTTGCTTCGGTTCAATCGAAGAAATCGAGTACGGCGGCCCAACAATTTCGCTTGCATTGAGGACATGT
AAGTCATTGTACCAGCGGTTCGCCCATCCTCCGAAGAAGATCAAGTGATTGGTGTTTGAATCGAACACCATCGCAGTGTCAGCGCGCGCCTTTGGGAGTT
CTCCTTTTATCGGTGGATTCAGCCACACCATACTGCCAGTGTCCAACACCGCCGTGCTGTTCAAGTATGCTCCTTGCGCCGTTCCTGACTCGGCCAAATC
TCCACTATTGCCACCAAACAAGAACACTTTCCAGTGAGGTACAGCCGCAACACTCACACAAGTGTGATTCCAGATGGGTGATTGAAGAGGTGTGCTCAGC
AAGCTCCAGGTCTTGGTGGGCAAGTCGAAAACAAAGATGTCTTGAaactgcttgaagctgttccaCCCGCCAATGACCAGCAACTGTTCTTTGACCAAAC
ATGTTTGGTGCCCAGAGCGTGGCTCCGGTTTTTCGCCTTCAGCTTGAATCTCTTGCCACTTGAACGAGTGCAAGTCCAACGCATGTAGGTCATTGAAGTC
GGTACGACCGAAGCCATTGCCGCCGTATCCACCAAACACGTACATCTTTTCGCCGACAAGCGTGGCACTATGAGCTCCGCGGCACTGCGGTAGCCCCTCC
CAGAAGGCCTGGGCGTACTTCTGCTCCCACACCTTCAATTCGGTGTTGAAGATCCAGAGGTCATTCATTCTCTTTTCAGCCGCAAAGCCTCCAAATATGA
TGATGTTCTTCTCAAACAAAATGGCAGAATGTCTCCATCGTGGTGCTGGGACTTCGTCGTCACTCTGCGAGCTTGTTACCTTAGACCACGTGTAGCCTGC
CGTTAAGTTAAATTCACCGTTAGCCCAGATCATAGAATGCAATGGGTGTGCTGCTTCGCGTCGCGATCATCCTACCATTTGTGACGTCCAGTCTGTAGAG
CTCATTGGTGGGTCCTGGAGGCGATTTGTGATCGCAGCCGCCGAACATGTAGATTGACGTTTCCGTCTCGGAGCTTTTCAAAGTGAAGGAGTGCCCGGAC
CGCTTCACAGGGATGTCTCCATTCTGCTTTGGCGCAATCCACGCGAGCTCTGGCTCGCATCCATACCCGATCGGCTGAGAAAAAGTAAACAGTGAAGCAC
ACTTTCAATAAACCTTTTCAACCCAGCATACTGCTCGGTCCAAGCGACGCACCATTTTGGCTTTGTCCTTGGCGGGGTGTGCCTAGACTGGAAGCTGCCT
CTTGGAAGGAATTCCTCGCACACTCGTCAACTCTGCCAACCTTCTTGCTTTCTTCAGCCCTGCCGGACACTATCGCTCCGTCGTCTCTGTAGTATCCGCC
GAGCTAGGTGAGGCCAAAAACCACTGTACCACACCGTGAAAAACGCCTAGATGACATTCAAGAGGCGCGACGGGTCAAACCACAGGCAAGATATCGCTGT
CCCTTCATCGCAGTCCGTTATTGCTTGCCCTGTACCAAGCAAAtacaagcgcttccagcaTTAACCTGTAGACCGTTGTGTTCAAAGCGCATGCTTTTAT
TTCATTGCGGGCTGCTCTGCAATCGCGCTCTTCAATCCGCATGCTCTACAGTAGACGTGGAGACATCATCTGCAACCGGCACTCATAATCACACACCACC
CTTGGATAGAGCAGTGGCTTAGGCATCGCGGTTACTCGACTCACTCAACTTCACTGGGCAGCAAGCAGTGTATCCACCTAGTTGTTGAACTTGAAGAAAA
TAATGTCGCCATCCTGGACCTCGTACTTCTTGCCCTGCTGTTTGAGCTTGCCAGCCTTCTTGACAGCCTCTTCCGAGCCCACTGTATAAGTTCAACACAT
CAAACGTTAGCTCACTTGACAAGCACACACAGATATATAGATACCCCGCCACACTTACGCTCTTTAAGGTCGGCGAACGCCTGGACTTCGGCCATGATGA
AGCCCTTCTCGAAGTCCGTGTGGATCACACCAGCAGCCTGGGGTGCCAGCCGTCCCTTGCGGATGGTCCAGCCACGCACCTCGTCCTTACCGGCCGTGAA
GAAGTGGACCAGACCAAGAGCCTGGTAACCCATACGGAGCACGCGGTTGAGAATCGACTTGTGCGTCAGGTTCTCCTTGAAGTACGTCTCCAGCTGGTCA
GCAGCCTCgaggtccagcagctcgagctcgaactcGCAACTGAGAGGGACCACGGGCTCGTTGCCACCGCGCTCCTTGATGTACTCGGCGATCTTGGGCA
GGTACTTGTTGCTCTTGCGCAGGTAGTCGCGCTTGCTCACGTTGATGAGGTAGACAACCGGCTTGGCCGTCAGCAGTTGCATGGTGTTAAGGATCTCGAC
CTCGGGGGCGGTCCACGTGCCGAAAGACACGTCCTTGCCGGCCTCGAGCCACTCCAGGATCTTGCACAGAGCCTCGTAttcgagcttcttctccttgccg
ccgacgccgcgctccgcgagcttcttgacgccCACCGACTCCTTCTTAACGCGCTCAATGTCCTTGAGACGTAGCTCGTCCTGGATGATCTTCATGTCAC
GCACAGGGTCCACATTGCCCTCCACGTGGGTCACCTCGGTCGAGTCGAAGGCGCGCACCATGTGGTAGATGGCGTCCACGGCCTGGATGTGCGACAGGAA
GGCATTGCCTAGACCggcaccttcagcagcgccgcggACGAGGCCAGCAATGTCCGTGATGGAGATCACGGGCGGCACGACGCTGGTGGGCTGGTACTTG
TCCACGAGCCAGTTGAAGCGCTGGTCCGGCAGCGGCACCACGGCGTCGTTCGGGTCGATGGTGCAGAAGGGGAAATTCTCGGCCGGAAtgtgcagcttcg
acaggCAGTTGAAGAACGTGCTCTTGCCCACGTTGGGGACGCCCACAATGCCGATCTTGACGTTGTTACCGGGACGGCCCAGGTACGTGCGCGTGGGCTG
CAAGTGGAGGCAAGACGAAGGAGCGTACAGTTAaagagagggggggggcacttGTGGAGGTAGAAGGGAGTGAGTTACTTACCTCTTCGGTCTTCTTTCC
CTTCGGCGGCATGATGGCTTGACTTGAGTGAGGCCTCTCTTGCTTGATAGACTGACGAATGGCGCTCGTGAGCTTTTGACTCACtggtgggtgggtgggt
ggggATTACCCCTTTTCGTCACAGGGTTAAATATTTAACCCATCGATACGATTT