Description :
From Genome Similarity Track
Location :
Scaffold_15:84929- 99724
Transcript NameFunction/comments
Phyta_totarag968hypothetical protein PHYSODRAFT_495691
Phyta_totarag969hypothetical protein
Phyta_totarag970hypothetical protein PHYSODRAFT_497872
Phyta_totarag971hypothetical protein PHYSODRAFT_543923
Phyta_totarag972hypothetical protein PHYSODRAFT_298688
Phyta_totarag973hypothetical protein PHYSODRAFT_496973
Phyta_totarag974RING-box protein 1

Sequence
14795 bases(100 bases per row)
GATGAACTGAGAATGTCCGAAATAAGCGCTGGAAAGAATTGCAGTGTCTGCGATGCTGCAGACCAGCGCTATATTTACCAAGCACTCAATGCTCGCAACC
TCCCATGTGTGTCAAAGGCGATTTTTAGATGGAAACCCCCAGAGCTATGGTCTATCTCCGGTGATGCTTCTTGTCCGATATCTTGTCTGGAGTACTTGGC
TTGTTGGTTGGTGTCCGTTTTGTCCaattcagcagctcattctCGATTCAGCTTGAGCGAGTgcgagaggaagaagagaccGAGACCAAGCGACTGACAG
CATGCGCTATCGGGAGGGACTCGCGTTGCTCCTGAGTACGACGATGGGGTGGAGCCCGGTGCTTGGGACAACCACGTGGCCAACAACGTGCTCGACCGCG
GCGGACTTGGCGTGGCAGGGCACTTGTCCGACACGCACGGTGGATAACACCAACTACGTGTCACCAATGGGAATGACGTCGGCGGAGATCAACGTTGACG
AGAACAATGCCGCCGTTGCGTACAAAACGGCACGTCAGAGTGCACTCAAGTTGAGCGCTGTTGCGGGCAATACCGCTATGTCCGGGATGcgcaagaagag
cgagagctGGTACAAAGAGTCCTTAGCTAGCTTCACCACCTACATCTGCGTgacatcgtcatcgacaGCCGAGTTGGAGCGCTGTGTGGATCCCTCAAGC
GGCGATGCTGTACGTGACATCAACGGCAAGTGTGTTGCAATGCTTGACGTCGATTCGTGCAACAGCATGGGGAAGTGTGAACGCAGGAGCAACTGCAAGT
GGGACGACGTTGTGCCTAACGGAACAGAAGCCCGTCGTCATCTTTTCACCGATGCGAATGTTACTACTGCGACCAAGTGGATGTCAACGGGTTATCCCAG
TTCCTTAGCACCTTTTGTGGCTCCTGGCACCGTCATGGGCGTGCTCACCGCCCTGGGCTGCATAGGCTTCGTCTTGCTTCGATGCGTGTTTAACCGCTGC
GGTGGTCGTGAACCGAGTGAGAAGGGCTACACGCGCTGTGATATCATCATTCCAACTCTCACCTTCCTTGTGTGCTCGCTGGcggtcttcatctgcatgG
TCATCACTGCAGCGCTGAACACGAACATCTCGGATGGTGTCGAAGACGTGCTGTACTCTTTGAAAGCCACTTTAGAGAACGCAAACATCTTCGTGGCCAA
CTTGCTCACTCCCCTCAATAACGCCACCACCGAGCTAACTGTAGCTTCCAAGGCAGTGAACGCCCAGCTAAAGAACTCGGCCTGGATTGCTACTGACGGC
GCTACACTCAGGAATATGATTGCGGATTTCGGTAGCATCTACTACAATCACGGAGCATTTCCCTCGCTGACCTGCGATCCCGCCACAAGTGCGACGTTTT
GCATGGTGTGCACTGACAGAGTTTGTGGGTCTCCCGTCACATTCTTTGTCAACAACACTGCTGCCGCTATTTCGGCTAGCAGCGACGTGGTTGGTGACAC
GGTCAGCTTGCTGCAGACCTCTTTTGTGACTGGAGGCAGCGCTCTCAATTCGACTCTGCGGACGGCAGTACGGGACATGACGGCTTTGGGCGCAACGACT
AACAGCTCCATGGATGTGGTGGACGTGCTCACTAGCACTTTCAACGACTTGTCCTTTTCCCGTAGTGCGCTTGTGGTTTGTGTCTTCCTGTTCGGAATGA
TCGCGTCGATTGTGGGCATCATTGCTATTGTCAAGAACGCCTgcacgaccaagacgacccAGTGggtgcacttgctgcacgtGAGCTGGTCATTGGGTGT
GCTGGTATGCGTGCTGAGTTTTGTCCTGTCGGCATCCCTTCTTGCGGTCGGAGCTGTGTGGTACGACTCGTGCGAAtacatgaagctgttgcaCCAGGAT
ATGTCCCCGTATGCGTCCACACAGATGTCCGCAATGGTGAATGCCTGCTTCAACGGCAGTAGCATTCTAACGCCGCTGGGACTCGATATCCCGCTGTCCT
TCTCGTGCAACGTAGAAGATGAATTCGGTATTCTCCAGGCAGCCGACACGGCAAGTGTAACGACGGCTATCGCGAGCTATGGTGACATTGTCTCCAACTA
CGATCTCaccgacttcaacttcaactcgacgcGCTCGAGGAACCTTGTCGCCAAGCTTGCCACTGCAGCTGAGGCTGCAAACATGAAGCCGCCCGTGAAG
TTCACACAAGAGAACGTCTTGACTCCCTGGTTGGCATATAGCCAGTCGTCCACCACCTACAATGAAAAATGTAGCAACGTGATCGCAGAAGAGCTGCCAG
TGTGCTACATGGACAAATTGTGCGAGTCTGGCAAGGCCAAGACTACGGACCAAGCCGCTTGCCAGCTCGCTTTCTACGAGGTTTACGAGTATGCACTCGC
CTTTGACCAGGCCAGCAcaatgctggacgagatgcgCGAAACTCTTCTGGGTGATACGGGCAAAACGTTCCCGGACCAATGGAACTACTCCGTCTCCATC
AGCGAGTTCGCCACCAACTACTTCACGAAGATCACGGCTCTGAAGACCGGTCcgctgacgacgatgctggGCGAAAAGGGCACCGTGCGCAATCTGCTCA
CGTCCGTGGAGCAGGCGCGTTGCTCGGGCGACTGCGCGTGGGCCAACTTGTCCTTCGACGCCATCAACGAGTCGCTCTGTAACAACGTGCTGGGCACGAC
GCTGGCCATATCGCTGTGCGCGCTGTTCTTGAGcctgttcttgctgccgctCATCGTCTCGGCCATCATCCTGCAGAAGCGGCTGCGTGGAGTGGCCAAG
GGAACATATGACCAGCTGGAGGCgcgtctgcaggagctggagcgccgcgccaagcagcagaaacagGAGAGCGAGGGCCTCTCGCCCAACGGAGCGAGCG
CCAAACCGACGGGCGGGATCAGTGCGCTCGGCGGCCTcttcaagggcaagaaggtgcAGTCGCCAAGCACCTAACTAGCTGCAACTTagaccacttcaac
cacttcaacttggatATCATTGGTCAATATAAAGTTTATTTTCATCCAATCCACGATGTTTCGTGTCCATGTTGAATCGCTGCATTTCTACCAACCAGAC
AAGGCCAGTTCCAGGGTTCTAAAGAACCCACATTTTGGGAGCAAGATGGGTGGGTGTTAGGTGGGTGGGTTTTAAAACGGGGTTTTCAAAGTGAATGACG
TCCTAATTTAatcttgatatttgtattCTATAAATTTGATCCGCGtctgtgtacatgtacacaacaTACACACATTTCCTAAAATTATCCAGCttacaaa
tatcaagtaaAAGATTGATTTGAAATACCCAAATATTCCATCAAATAATTTGGGTGGGTGGGTAAATCGGTCAAAATATCCAAAGCGCATTTATTCTAAA
ACCCATTTGAGAACCCTGGCCAGTTCAGTATccgccaagcagcaacgaagTGACGAGGTACGATGGTAGCTCGCGACGTGGTCGTGCTCGGCGGCGGCAT
CTCCGGCCTTACTCTGGCCTATTTCCTGCGCCAGGCACTGCCCAAGTCTGTAGCCGATGCCACGCGCATccgcgtgctggacgccaactCTATCTCGGGC
GGCTGGGTGCAAACGGCCAAGAGCGAGGGTTTCCTCTTCGAAGAAGGACCGAGAGGCTTCCGTCCGTCCCGCAACGGCGCTGAGATGCTGCGactggtgg
agcagctgaagcttcaaGAGCAGATGCAGGCAGTGGATCCGGCGGCCCAGGCGCGCTACATCCTGCGCAACGggaaggtggagaaggtgccgAGTTCgat
gctggaggcgctgcgctgGCCTCTGTCGCTTGCGGTGGCGCGTGCGGCACTGCACGAGCTGTTCGTTAAGCCTGGAGCAGTGGAGGACGAGTCAGTGTAC
AAGTTCATAGCCAGGAGGTTCAGCCCCTTAGTGGCCGAGAGGCTGCTGGACCCCATGGCCTCGGGGATCTTTGGTGGAGACGTTAAGAAGCTCTCGATGC
GCTCGTGCTTCCCCATGTTAATGAACTTGGAGAGGGACCATGGGTCAGTGGTGAAGGGCATGCTGTTCGGAGGCTCTAGAGGAgacgacacgctgctgga
tggcTCCAAGAAGTCGGAGTTTGTCAAGAAGCACGAGAAATCGGTGAGTGTGAGCTTCACGGAGGGCATGCGCACGCTGATGGACTCACTGGCAGACAGT
ATCAAGGCCAATCCGATGGCGGATCTTCAGCTGAACACGAGAGTGACGAGACTGCAGGTCCATGGACTCAACAACGCGTCGTCGAAGGGACCGAGTTTTG
TGGTGGAGAGCAAGGACTCCAAGTCCGGGGAGATCCGGGAGCCCATCAAGGCCTCGCACGTGTTTTCTACTATACCCGCATGTTATCTGGCCCCGGCGGT
GAAGGATTCGGCGCCTGGTTTAGCTGAGGCGCTGAGTGAGATCAAGTTTGTGGACATGGGCATGGTGCACGTTGGATACaacgagaaggtgctgccTACC
GATGGCTTCGGGTATCTCATCCCCAGCGCAGAGCGTGAAAAGGTGCTTGGCGTCGTGTTTGACTCCAACACCTTCCCCATGCAGAACGCCCACGGAAAGA
CGCAGACGCGTCTGAGTGTCATGAGCGGCGGTGCTCACTTCCGGGAGGTGGCATCGCTGCCCGAAGGAGAGCTGGAGCACAATGCTTTAGACGCCTTGAA
GCGACACCTCGGTATCACGCGGAAGCCTGACTACGTGCGCACTTTGACACTGACGAATGGAATTCCGCAGTACAACGTGGGCTATGgtcagacgctgcag
cgtaTTGAGAAGCAGGCCGCTCGCAGTGCACCGGGTCTGTTCCTGGGTGGCAACAGCTTTTATGGCATTGGACTGGCTGACTGCGTGACCCactccaagc
agctcgcgctcaAGTATGCCAAGAGTGTGTCATCTTCGAGTGGCTAGAACAACGAAGCAGGTTAGTGCATGTGCACGTTTTGGTGTCTGAAAAGTGTGCC
GTCCAGGTATCTTCCGCGCTGCGGTGAAAATGtacattgctgctgccgttctcGTTGTGGAGTGTCATGCTTGTGTTTGGCTATTTACGCTGCCCATCGG
AACGCCTTGTTGCGCCTCTTGCCCAGCGTCGCCGCGAAACGGTTTGTCGCGGCCTCGCTGTAAACAAGCGACCGGTTGATCTTTAAAAGCTGTCGGCACG
TGCATCGTGCTTCGAAAATATGTCGCGGACTGTGCCATCGCGGGCACTTGATCCTGTCTATGGTAGGCCTCGCGCGTTCGTTGTGTGCATATCGGAGATG
CAGCTAACTCTTGTGTCGTTTCTGCTTCCTGTCCTATGTAGATAAGGTGTACACAGTCTCGAACTCAGGTGGCTCGTTCCGCAAGGGCGTCTACAGATCG
TCTTCAAAACATGCGAGTACAAGTAGCGCCATCAACAACCAGAACCCAGCCGAGGGCAGTCAACTCGTCAGTGGCAGCGAACGTGTCAAGTTTCATCGGA
GACCAGTGTTGCCGCATCTACAAGCGGAACCACCAGAAGTCTTGCTAGCTCCTGTGTATGCTGCCCCACCATCACCAGTCAAGCATCGAGATGCAAAATC
GTCCACTTCCTCCTACGTCGCTGCCGATATGGATGATGGAAACACGCGGTCGGTAGGCATACAAACAGCTTATCGCGACTCCGAGGCCCAGACGGACCCA
TACACACCTGACTACACCGTCCAGAAGACTGCCACTGGAGTAACACCCGAGATAGCATCGCTCACTGGGCTAAGTCATGCACGGGGACAGCTACCCGTTG
GGCAGGCTGAGCTGGAACTCATCGAACGCAACCGCAAGAAGCGCGCCTTCGAGGCGTCACTGCCACCTATGACCGACGAGGCTAGCTTCCTACTGCGTAA
GGCAATGCTGGAAGCACAGGAAACCTGTGAGTGGGCATACCGCGAAGCTGAAATCGATGCGTTCCATGATCAACGCGTAGCTCTACTTGAACAAGCACTT
GCAGAACGTGAGAAAGAGAACGCGTTTCTGTCGGAGCAACggcttgaagcgcttcgtCAGCGGCTACTTCACGAAAAGGAAAACGCACTTGAAAGTATTC
AGCAGGAGCGCGTGGCTGCACTGCGGAAACTGACGAAAAAACGCGCTCAGAGGCAACACGAGCGCGGATTTGGGGCGTCTAGACCTGAGCGAGGACGTGA
CATCATTGCCGAATACGCCAATTTCGGCTCACAAGTGTATGCTCCAGTCACGCGCGATGGTAAAGCTGGCAAGATCGAAGTTCGTGAATTGGGTATCGGT
AAACCtcagttcctgcagcttgatgCGTTACGCGAGCTTGAGAGTGCTCTACCCGCGCGAATGTTGCTACCAGCTGCGGGCAAGTACAAACCTCGTGAGA
AGAGTGGCCGCACTGCCAAGGACAGGAAGCAAGCGGCGATAGAGGCTCACCTCCTTAAGATGGAGTCGATTATCAAGAAAAACAAAGAGCAGAATGAGAG
CGCAGGCGACGCAAGTCCTGGAGCACAGCAGAGTGTTACCAGTCCGATTTCTCGACGGGCTAGCCAGAAACAACAAACGCTTGTACGCCCACCCACGCCC
GACTACGCGTTGACCCATGTTGCTGACACGCAGGAGCACGATGTGGAGGATGCTACGCGTTTACTGCAAAAATTACTGCGCGGCCGTGCTGTCCAAAACA
TGATGTTCGAGGGCAAGGAGAGGAGATCTGAGCTTATTGCAGAGCTGCGTGCAGCTGACGAACAATTAGCTCTTCAACGCCGCCATGAGTTCGCACTCTT
GCAGGGATCTGGCAACGAGGCGATTGATAGTGTTGCAAATGCAGCGAAAACTCGCGTGGAGGGTGAAGTGGTCTCCGAAATGCTCGACTTCTTGTCTAAA
GAGCTCTCTCGATCACGTGAGGTGGCTAAGATGCGTGCTTTCGTGATTAAGGCGGCTGAACAGCGACGCGTGCGCGAGATAGAGGAAGGAGGTCGACGGC
AAGCTGAAGATTTACTGCGTGAGCGTGAGGACGAGGTCTTCAGACGTGTGATGCAGGTACATCAGGAAACAGCTCATGACTTCGTAAACGATGTGCTGGA
AGAGGTAGCGCTCGAGCAATCTCATGCCCAAGcactgcacgagctgcatgTGCGCAGCGCTGGCGTGGATGGAATCGTGCTGCGGATCGAGAATGAATTG
GACAGCGACGAAACCGTGGTGCGCGAGCTTGTAGCAAGTTTCTTGCTACCTCGtgtccagcgacagcacgtACGTCGCCAAGTCACGCAGGAACAGAGGA
AATACGTGACAGCGGCGCATGCGCTTCTCACTGAAATGGCTGCAAGCATGAGTCAACCGAAGCTTGATCCTAGTGGAATAGAAGACGCAACATAAGCTCG
GTGCAGTAAATGAGTGCATGGTTTATCAAACGCTTGTTGAGACGATCGCTGGCATAGTGGCTTATCAATATTGACCTTTTACTCCCGAGCCACGAACGTC
TCTCGCTGTCTTTTGTGTTGAGTGCCTACACTGCTCGGTGCTTATGCATGTTTTGTTTATTTGTTGGCAGAAATACCAGTGgtgccacctccagcagacT
TGAGGAATGCGTCGAGATGCTGTCCTTGGTACTTGAGGaagtccagctcctccttgaaCTTTTTCTCCTGCAGAGCCTTTCGCTCGGCTGCTCGCTTCTC
AATGACCTCGAGTTTGTTGGTGAGTTCCGCCACTttgctctcgctctcgtcctTGTCACGCTGAAGACTGGCGATCTGCTCTGCCAGGTCGCCCATGCCA
TCTTCAGCCTGTAGTTGCTTCCGCACTCCGAAGTTTAGACTTGAGTCATACAACGTCTTGTAGGCATCCGTCGTGAGTCGCAGTTCATCGCGCACAcgta
gaagcagcaagccTCTCTCGGGGCAGTTAAGAGCCACTTCACGGATAAGCTCATCGCAAGCTTGGGAGTACAGATCTTCTCGAACAGGACAAATACCGCT
CTCGCGAGCCTGGCGCTGCAGTAGTTTGGCATCAAGAGCTTCCTGCAATTTCAGCACGTCGAAGCGAGTCGAGGGCACGCCCGACGCGTACCGAAGCCAG
AAACCTGAGTTTTCCTCGGACCACATCCTGCAAGTAGCAGAATCAACAGGTTAATagatcagcagcagcaagtaccGAGGAGACGGAGTGGTGGCGTACT
GAGGAGGTAGGATGGCATTTAGGATATCTTCGACCCGTGCAACACCATCAGAGCCTTTtccgtttgctgctgacctACCGGACtcggcagctgctgccac
gatAGTTGCTGCGGTGATTGAATTGGAGGAAGAACCTGCGTTGGTAACACCCAGGACCTTCTTCGGCGGGTCAAGCGTCTCGCCCGTGAAGATCGGTTCG
CCATACTGCACGAGCGATTCAGGGGGAATTGGCGTTGACATTTTACCTGGTAAAAAAATGCTTTAAGCTTTAGTGCTCGACCTGCGTCGGCTAGCAACCG
TCGCGTCCGTTCACTATCGCAAGCACCAAAACTCACCGTCGAATGTGCTTCATTGTTATTAGCTTCCTGCCTACAAACGCTGGTTAGATTTTGCAGCTAT
GAgttcctgcttctcctgaCGCTTGCGCTCCGACAGCTCTTTCGATAGCTGTTCCGGACTCTTGTAGTTGTCTTTAGCACCGACCTTGTGtcgccacttg
ctgctgttgctctgtCGTGCTGCCTCCAATGCTGCAAACTGCATCAGACCAACTCGATTCAATTATAACACACTCAATAGGTCTGTACAGCATGTAGCAG
GCTCACGTACGTGCTCGTTGCGAACAGTTTTTGTCAGCTCGACCGACTGGTTCCAAGACGTGGCATCACGCAGATCTGGATGGTTGGGCAGCTCCTCCGT
GCACTTGGCGATCCCCTGCATCAACAGTGTGTAAGTCACCGCCACTTCGCATGCCTAGGATGTTTCAATAAGTGGCAAACGCTAAGCCTTACTTTCATCA
CGCGCTCGTCCCCAAAGGCTTCTCCCGCATACTCATCCTTTAGAGCCACCTCCAGGATACCTGTGTTGAAGCGGGTTGATTTTGGCTTGTGTGTCGGGTT
CTTCTTAGGAAGTTTCTCGGCACGGAAGTTGTACGCGAACATGTGCGCACGATTTCGCTGCAGAGGGGTGCGAGTATTAGCTTCACGTACAGGTCATCCA
TATCTACAAAACGTCGTCGGCCACATACTTCAGCGTTAGTGTTGGTTCTCTTGTAACACTTGCCAGTCATCTGCATGTTGTCCCAGTTTGAAGTCGCCGT
ATTCCATTGAGGCTTCTCCGCCGAAATAACGCGCGAGCGAAGCATTTCCATGACCTCCAACTTCGCCGCGGCCTTGTCAGGTGCTGTATCTCCTGGGCAG
AACACCCGTTCTTCAAAGGAATAATTGACTGGGGCATCCTTGCCTCCGATCCGCTTTTTCGCATGCACGAAGGTCGTCGCCCCATCAGCAATTCTCCCGT
CATTCGCAGCAGACTCCATTGCTATCGTCTCTCACCGAATTTGTTTCCAATTGGCCTCTTTGGTGCACACCAAGAAAGCTGAACATAACAAACAACACCG
TCGAAAATATAGCACACGCAGCTTCATAATAGAGGGGGTGCAGGGATCTATTACCGTCGACAAGTCTTGGATGGATCCGCTATATTTGGTCAGGTCAGTG
TATGTGTGAGCTTCACTGTGACTGGAGACATGCTCTTCACATCTTAAGCCGACTCGGTagccgcagcggcagcggcagcggtTTGGACTTGTTGGGCTTG
TCGGATACTGTTGCGCTCGGCTTGGAGGTGGCGGCAAAGACTCTCTAGCTTTTTgaccttctcctgcagcttcaacgtctcCTTAGCAGATGCCACCTTC
CCTTGAATTGAGGCAATCGCACCGCTGTCGTACTCAGCACACTTCTTTTTGAGTGCTAGATTTTCCTTCTCCAGTTTCTTGGTCGTTTTTGCCATCTTAT
CCATTTCTTCACGGAAGGTAGTGAACATCTGATTGCTCTTCGCCAGTGTTTCCTGCACCACATCAAACTTCTCCGAGTAGGAGTTGAGCTGTGCTTGCAA
CTGAACCTCGCGATCGGAAAACTCCTTAGCCTTGTCAAGAGTGATTTTCACCTTCTCTGCCTCACGCGAGGTTAGCTCTACCTGGTGTTGCAACTTCGTT
TCAGCAAGCTGGACGGTTAGATCCTTAGCCTCCAGCTGCCGCTGAAAATGCTCTTCGCGCGCCATGTATTGCTCGAGGAATGTCTTTAGCTTGTGCTGAA
GGCTGTGCATTCAGTGTAGGCAAAAATGAGTTTGGGCATTAGTACAGCTTGCTAGTTCACAAGCTGGCACACAGACGTACTTTTCGTTCTCTTTCAACGA
GGCCACGTAGTCCTGGCCCTGCTTGTCCATTTTGAAACTCACTTCTTCGATTGTTTTCTGAAATTGGGCCGATAGCTCGCGTCTGAAGCACCAAACAATA
GTCAAAGATAAGTAAGATGCCTGGAAAACATCTTTCACGACCGTCAATGATCGCATGCATGCCTCTTCTGGTCCTCTTCGTCAGCAATACGACGGCTTTC
ATTCTGAATAAGTCCAACATAAAAAAAATCCCCGTCGAAATGTCAACTCGGAACCGAAAAATCATCCATGCTGCTCCAACTCACGTACCACAATGAGCTt
gttctgcttctgcagctcccgACAAAGCTGTTCCAGTTTGGCCTTCGAGGTGTTTgacttggccagctccgtgCTCACTACACCAAATACAAATCTGTAA
GTATAAAAGCCACCCGCAATGCATCTGAACAAAAACGCACCTATGCCCTTACGTTGCTTGAGCAGGATACACTTGGCGTTCAACTCGCCAattttcttct
gcatcagTTCCAGTTGTTCACTCTACAGAATTCACGCCCAGCTCTCCAATAAGTCTCTCCACCCACCTCATTTTATCTCCCTCTCTAAGCGTCTCCGTAC
CGCCTGATCGAGACTGCTGAcgagctccgccaccttctcctcggcCGGCATCTCCTCATTCTCCTTCACagcctccgccttctccttcagctgcaatgGT
AGCGCCTCGTCCTGGTAAATGCCTACAGATCACATACAACCCACAGGTTCCAAATAATCAATCCACCAGGACGGCCGGCAcccatcgctgctgctgcaca
cacCCGAGAGGTCGTCGAGGTTCTCGTCACCGCCCACTTCGATCTCCGCGATCTTccccgccagcagctcccgcAGCGCGTCCTCACGGTTGGCTTTGGT
GTTGCGTTTGCCGTGCACATGGTGACGTCCGGGAGAGGCCGCAGACGACGGCGATCGCTTAATCTCTGCGCCTTTGCTGGAGGTCGCAGTGTCGTCTTTG
cctccacgctgctgctgcgagcgtTTGctcttgtgcttgtgcttgagGCTCTTGGTCTCGCGGCccagctgcttgagctccagGCTCGGGGTCTCCATGG
CGCGCGTCTGCTCGTCCGACATCTTTGAATTTTCAGGCTGGCTGGTGCCACGCGTCTACTGAATTAAGAGTGACAATCTGAACGCATTAAGTACGTTTAT
TCAGTAGTTTTAGACGACGACCTGCTTGAGGATGTCGAGCACTGCTGCCGAGTCTCCAGTAAGTGCAGACGCTTCAACATAGATCACGCCGTGATCGTTG
CACCAtgcacgtgcagcttcttgctcttcttgggcaTCTTGGCCCAAGCAGTCGCTCATATTGCCAACCATCACAACTGGCAACGATTTAGATGATTGAG
TTTCGATGGTTTCGGCCGCGGTAATCTCTCGGCGGGCAACGTCGAGGTACTTGGGCAGCGCTCGCCAGGAGGCTGGCATCTGTAGGCTGAAGACCAGCAC
TACTGCCTGGGTGCTGTGAAAGTAGCGCGCGAAGATGCTCGGCCCCGCGAAGCTCTGCGGTGGTACGTCCCACAGCTACAGACATGTACCAATCTCCGTT
AAACCAAGACCAGgccagcaccaagcagacATGTCAACGACGCACTTCTAAAACAACTGGCTCCTGTCCCtccagtcgaagcagcttAGCACCTACGCTG
GCTACATAGCCAATGCATCAACGAAGAGCTGTTAGATTTACGCATGCACGCATCAGTGAGTACGCCTCGCTTACTGTACTCACCCGCGGTGGATGGCACG
TAGTCAGCGTCGAGCGGAGACCCCACCCAGCGTCTGAACAGCGTCGTCTTACCCACGGCCGCCTCGCCGAGCAGGATCACCTTGAGCTTGCCCACGGAAG
GCGAATGGGAGCCCTTATCTTGCTCTGCAGACGCGTGCCAGGGCCGGCTGCTGGAcactgcaccagcacatcTTTAGTccctgcagcttgaagcttACAA
ACAGAGCTCGTACGCCGCCCACGTTATCCATATCGTGTATCCGTGTAAGACTTTGTAAGTAAAACAGGTAAGGCCCTCACCTCGTCCGCCCATACGTTGT
GCTGTTTGCAACCAAACTCACCACCGCCTTCAGACAAGTCTCATTCAAAACTGAAGTTGAAAGAACCTGTTAAACTCGATTTTATGCCATCACAAGAAAC
AGGTTTCGTGCTTGGTCCGCCGTCGGATAAGGCGGAAATGGCGGGCGATGTGCGCGTTCAGAATGCCACCCAGCGCTTCACACACGCGCAGCTCTTCACT
CTGCGATTTCCTCGTCCGCGCTAAAGGGATCGACATCTGATAACGAGTGGCTGTCTCTGCAACCTCTGGACAAGCGATGGACCCGGTCGACGAATTTAAA
CTGGTCGCGGcgctcttcatcttggtgctggcgctcatGGGCGGCCttgcgccgctgctgagcagccaGCGCGTGAGCAagcgcgccagcagcgtgctCA
ACATGGTGGCGGCCGGCATCTTCCTCGCCAGCTCGTGCATGCACCTGCTGCCGGATGCGCAGAACAACGCGGCGCTCACGGAGTGGGGCTGCAAGCACAC
GGCCGAGGTCTTCCTCGCCGTGAGGACCCGCTACGACGGCGACAACAAGCGCTGCTTCAAGTGGGCCAACTTCTTCTACGGTTGCGGCTTCctcttggtg
ctgctcatcGAGGTGCTGGCGCACACGCTGCAACGGCACTACAGCAAAGTACATGGCCACGGCCACGCTCATGGCACAGAGCAAGAGagcgacgcgctgc
tggctaTCGAGGTGACTCGTGCTGCCGAGGTGGACAACCAGGCCAAGACTAATGGACACTCACACGACCAGGTGGAGACTGGAGACTATGGCACTCAAGG
AGAAAGTATTGAACTACCTGTCCATGCCGAAGACGGCAAAGAGGAGCCACACTCGCACATCCACGGCATAGTGAAGGGCAACTCCATTctggcgctcgtg
gtgttCATCGCTCTGTCGTTCCACTCCGTGATGGAAGGCATGGGCATGGGAGCCTCAATCACCCCGGCCTGGGATATTCTTGTCGCCATCTTGGCGCACA
AGTCGCTGGCGGCGTTcgcgctggcgctcgagTTCTTGCACCACAACGTCTCGCGGAAGCAGCTCCTGTCCTCCGTAGCGGTCTTCTCACTCATGACGCC
CATGGGCATCCTGTTCGGTCGGCTGCTGGTGGATACCAACCACGCGACGCCTGCGGGCGGTGTCTGTGCCGCGTTCGCCGGCGGCACCTTCCTGTTCGTT
GCCATCATGGAGATCATCCcgcaagagctgcaggacccACGATACCAGCTTGAGAAatgctctgctctgctcgCCGGCTACGGCGCCATGGGCGTGCTCT
CCCTCTGGACATGAAAATACTGTTGACTTATGTATTCTCGAAGACAAAAAGTCTCGAACATCGTTAGGCATTCACGTAAACCGATTTGCCTGGTGCGAAG
GTCAAATTCAGAATTCACTGATAACGTTAGTAAAGAAGTTAATGAGAAAAAAACTTACTGAAGTAGCTAGACCACGCCCCAAACTATCGGGCCattctcg
agcttggtgtGCGTTGAACCtgcgtcttcaacttcacacCCCAATTTGCTTCTACAGTCGACATCGTAGCCAGCAGATAGACACACAGCCAGGCGTCCTG
GGTTCTTTCTCTCTCCATCGCCGCTTATCTGCCGTACTTCTGGAACTCCCACTCGCGGTTGTCCAGCGGACACACCTGGCGAGTCTTGAGCCACCGCGAG
ATGCAGTGAAAGTGGAAGGCGTGGTCTGCCAAAAAGAATAAGGAACACAATAATAATAAAGTAAATAATCGTTCAACCCGAGTCCCCAGCCAACACAGGA
CGTACTGCAGACGCCCCAGGCCACTGTGCACTCTTCGCTGGTGGCTGACGCCTGGTTGGCCTGGCACTCGATGCACAGGTCCATAATGTGGTTGCGGCAG
ATGGCGCAGTTGTCTACCACGATGTCTGCGCAGTAAGAAACAATACAAATAATAATTAATTCCTGAAAGATCTTGAGTGTCTGGTGGACGATATGACGCA
CCCCAAGACCAGAGAGCCACAGCGTTCCACTTCTTGATCTCGAAccgcttctcctcgctcgtAGCCGCCGCCGGCGTCACCTCCGTCTTCACCTCGCTCT
TCATTTCCTCGTCCATCGCGCCTGCACTAACTGTAGCTCTCGCCTTCGACCCCACCAAAGTAAATGGTTTCTTCCTCCCTGCCACATTTTCGTACCTAAA
CGAAATATCGCGGTTAGGTACGAACGGAACATTGTACCACACGTCGGATAGGAAaagtcacttcaacatcaattGAAAGAGAAAGAGTGCCATTC