Description :
From Genome Similarity Track
Location :
contig_12:849243- 850269
Transcript NameFunction/comments
g3306.t1hypothetical protein PHMEG_00023506

Sequence
1026 bases(100 bases per row)
AGTGGCCTGTGCATCGGTCGTTGATGCCTGCAGCAAAAGCTCTTGTTGGCCCTCTGCTAGAAGAGCTTTCCTGTAGCTAAGGCTTGGCTTGAGCTTTGCG
GGTTGTTTGGATGGTTGGAGAGCCCGACGACTTGGCGCCGAGCGCTGCTAATCGATGGGTGTTCCCCTTCTCTTGACTTGCACCTTCAAAAACGATGCCT
GCATGCTTGTTTCCCCCTTTTTGCGTTGCTTTAGAGGACGATGAAGAGAGCAGCGACCTGTGAGCACCGCCAGAACCAACTCGCGCTGGGTCAACACTGC
CGAAAGTACCAGATGCCAGTCCAGTGGGCGGTTTTAAGTGAGGTGCTGAGCTGGTCAAGGCACCACCGCTCTGCAGTCCAGACGATGGGAGTCCGTCCAT
ATTCACGCTTCCAACGCCAAGTCCTGGCTTAGGAGCCCCGAAGGCTGCAGTAATGAGCTGAGCAGGTCGCTGTTGCTTTTGTTGTGGAAGGTTAGCCATA
GGCAAACCCACGTTCAGAGCCACTTTGTTGTTTGGAGGCGTACTGCTTGGTCCAACATCCTCGACAACAACCGGAGCCCTCGGTTGGGCTGACCTCAAGC
GGTGCATGACAACCAAAGCATTCACGCCTCCGTCGTCTTCCTTCACAGCTCCAGCGCCGCGTTCGTGCACACTGGTTAAGGGTTTTCTTTTCGCCGATGT
CGTTCGAGACTTGGCGCTTGCCCCTCGCAAGCCAGCGGCCGTCTTCGGGTCTGTCTCCTTATCGTCGCCCTGACCTCCAGAAAAGCTACCGAAGCCTCCT
AAACCGAAGGCCCCGAGCGTAATGATACTTGCACGTCGCTCACGTGACCAAGGCCTGTCATCCTGGACGGGTTCCGGTACATTGTTGCTTTCCAGAACTT
CTCGAGATGAACCACTAGGCGGTGGGGTCTTGGCACGCATAGTTTGCAAAGCTTTTGTCGCTATAAACCCCAATGAGTGCGTGGGGGTCATTGGAGGCGG
CAACTGCACTGGTGCGTTGTCTTCTT