Description :
From Genome Similarity Track
Location :
Scaffold_50:8492- 10091
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_50-abinit-gene-0.86GRF zinc finger family protein

Sequence
1599 bases(100 bases per row)
CTCGACTTGGTTCGCCACGTGCTTCAGCTCCTACGAAAGAAGAAGGGTTTCTTCACTCGCTGGCCGTCGGAGACTTCCTCAATCATGCTACTGAAGAATT
TTCGACCGCGTTGACCGCGCTCAATGTGCTTCTCTCGATGAGCGAGAAGGAGATGGCAGATCGAAGCAAGCTGAATCACTACCGAGATAGTTTGGTGGCG
TTGGGGATCCTCAATGAAGAGGAGAGTCGGGCAATGTTCGACAAGACGAAGGTGTCCGGTGGCCACAAGCAAGAGGAAGAGTGCGCAGTGGCATTTGAAC
GCCTTGGCGTGGTGAAGCGCTGTATGAGGCAACTACTGGAAAAATTGGAAACTCACGAGCCAGGGTCGGCTGTTATCCGAGCCTTCTGTCGATCCTTGCG
CTCGACCGAGCTCAAACCGATCCTGGTGGCTTCGGGCGAACAGATTCTTGACTCGCCCACGCGTTCACAGGAGCAAACATCGGATGCGGTTCCAGCCGTA
CGTGCAGCTAGATCAGAAGGCAATAAAGAGATCACTGTCGAAACCAACGCACACAAGGATCAAACATCGCAACTAACTCCACAACCAAGCCCGCAACCAA
GTCCGTCGAGCTTGAATGCCCGCCTCTTCGCCTCACCGACTTCAAAGGCCAACAGTTTGGAAATTGGTAACACGGGCGAGTTGACTCAATCTGTGATATC
GGTTCCTGAGCCGGCAAATATTGATTTCGAATCACATACAAGTGACACGACGAAAGGGGAAGAATCCGAGTTTGGAGCAGATATCGATCTCGACTTCCTC
GAGCCGTCCACCGCAACGTTTGGTACAGACGAAGACGATGTGTTTGGTGAGAAGGCAGTTGCGTCACTGGAGGACGCAGGAGATGAGACTGTATCTGCTA
CAATGGATTCTCGTCCAGAGTCTCACCACGTATCCTCGACGTCTCCAGCGACCTCCGACGTTACTTTTGACGCTCAGTTGCCGCCTGAGTCAAGTGACGA
TGATCTAAACCATTGGAACGGCGAAGCCTTGAGCAGCGAGACGTTGAGTGCATCAGTGGTAGGCAACGACGAAATTGAGTCTGTACCAACAACAACCGCA
ATGGACGAACCAGAGGTCAACACGGAAGGCGAGTCGAATTGGCTTGGAAACACCACGGCGACCGACGCGGATGCTGACGCGTTGGAGGCGATTTTGCAGT
CGGATAGCGGGGAAATCGACTGGGATCAGCATGACGAAGGCTCTGCAGTCACTAATGATGACAACACTGACAGCAACGAAATCGTCGCTGGGTCGATGGC
AGACGATGACCTCTTCACGAGTGCTGGTGAAGGTGCCGACGATCCCGAAGGTGCTGCATTCGCCGAAGAAATCACTTCCGAGGTCTACAAACAAGAGGAA
GTGGTCACCGAGCACGTCGACGAAGATAATGGTGGTGTTACCAGCAGCGAATTCGATTTGACGAACGATGAATCAGCCATCGTTGAGGATGAGACGACAG
AGTACAATCACGCTGTAAATGCAACTGAAAACGAAGCGGAATCAGGATATGCTGAGACTGAATTTGAAGAGTCAACGGCATACGATGGCACAGATGAAG