Description :
From Genome Similarity Track
Location :
Scaffold_74:84913- 89939
Transcript NameFunction/comments
Hyaar_Emoy2808102NAD-dependent epimerase/dehydratase
Hyaar_Emoy2808103hypothetical protein
Hyaar_Emoy2808104hypothetical protein
Hyaar_Emoy2808105p8MTCP1

Sequence
5026 bases(100 bases per row)
CTTTTTCATACTTGTGGATCTTCGCTTTTTTATAAGTGTACATGTGCAGGATACAACCCGAAGCTGCATGTGTCAGCGGTGTCACTTGGCTCGTCAGTAG
TAATTACGCACCACCGATACACCGATACCACTCGAGGATCCGAGCAAGGCGTGATGGACCAACCCATTGAATCGTTGACTTTGTATGGTGACGAACCAAA
CAGTGTGAGAGCTGTGACCTGCTTAGGAGCAACTCCTTTTTTGGTGTATTTTTTTTCATAGTGGCCCTATTTGTAGAATAAGGCGCGCTATCGGTTAGTA
GCTTGGTCTCAGGGAACGATTATAAAGAGCCTGCTTGCGATTTCTATGACGACTCGACTGGATATTTGGGAAGTCACAGTATCAAGGTATTGTTTGGCGT
ATCGGCGAGGTCACATTCTCGCTCTTATGTTCGAATGCGCTGTGTTGATCTCTGTCGTAGTGGAATCTGTGCGAATTTGAAGGGTTCACTGGACATCAAT
CATTTGCAAGGAATATCGTGGAATCCCTGCTACGAAGTTTTGCTCGTATGTTAAACGAAAAGTGTGCATGTGGATCTCTTCTGCAGTGTCGTAACGAGAC
AACAATGTTTGTTTTCGCATGTAGACCTACTCTAAGACCGGTACATCAGTAGTCAACGCTTCCGGACCACTCTTATCGTCGCGTCAGCTTTATGCAGATA
TTGAAACATATCAACCATGGAGCGCGCGTTCGTGGAGTCCTTGCGGGTTGCACGTGTCGCTGTACGTATTGGGTTCATCGTACCTCGATTGATTGTTCCG
TGTTCACCCGTACTTGATATGATGAAACAGAGCGCGAAACCGCGCCCTCCATTGTCTCGGCTGGAAAGACGTCGATTGCTTACTCTGTGAACATCCGGAT
CATGACCAAATTGATGTGGGCACATCGAGAAGCATCGACGGGTTTCAGATACCACTAAAACCAAAATTTAATGCATTTTTAGCTGAAATAATACCAATAT
CAACTAATCTTTGTTTCCAAATTCTATTATTTGTTAACATTTCTTCAATTTCATCTAAACGTGTATTAAATTGTTCACAAAAAATGTAAATATCATTTAA
TAAACCTTTAGGTAAATCTTGATTAACTCCTCCAGGCCGAAAATAGGCTGCATGCATACGTGCACCTGAAACTCTTTCATAAAATTCCATCAATTTTTTT
TGAAGTCGAGAAAGCCTGCGCCGGTCAAATCGCAGCTGTAGCACGTGTCTCTCCAACCGTTTGCATCTTCACGACGGACGCAAAATTAATTCTGGAAGAT
GCTACGCGTGAGTACCCAACATTTGCATGATAACGTCTGATTACGGAGCTCATCCCAACTGGACAGAATGTGCACCAAGCCTGTTGCTGTTCCCCGATAG
CACCCATCGTGTAAAAATTCGAGAAACGATGGATACTTCCGTCCGCGGTATCATCGATTTGACGTCCAACGCATCATGTCAGGCTTCACAAGTACCACGA
ACTCTCTGCAAATTCTTAACCGCGCTGAGGTACAAAGTCAGTCCGGCCACATGCCCGGAAGTCGTTTGACTGATTAGACTCTATGATGTTAACAATTGCA
GGGTAAAGCGCCTTACCAAACGTCAGCATCGCATGCGATGCCACGCTCTCAAATGTGGACTCTTGGATACACACCGGGGAGATGGTTTGTTATGTCGATC
CTCGATCTACCCAATTTGACTTCTCCCGACGTCTTCGTTGTTCAGGTGTGTCGTGTGTAATACTACCATGAGTTGTAATGCAGATCGTATACACCGATTT
AACACTTTGACCACCCAGCAGGAGAGGGTAGCCATCGTTGGAAGCACTATGTCTTCGTGTTTGCTTTTTGCGCACCTAAATAATTCCGATCCTTTGAAGT
GGACGCCGTCGCTGTATGGGGAACTCGTAAGTACCGCTGTTGCTACATCCACGGCGATGTCATGATGACTTGTATGCCTACCTTGTTGCTCGCATACTAT
GTAGGATCTGCCAACTGCTCACGTGTGCAGAGGAATCCGCTTTACCGAGAACTCCTTGTATGTGGACGTCGCTACGACGGAGAAACGCAAACGCATCTCA
TTTTTCCAAGCTGCTGCGAGCCTGGAACCGCAGCCGGTCTATCTGTCGAAGTTCAGAGTGCCACAATATGCCCTATCCAAAGTTGCCCTCGGACCGACTA
GCAAATTGCTGAATGTGACTGCATTTGCTGGTAATGACACTCCGAGTAGCTTTGGTGATGACAACTGCGATACCAGTACGCACACGGACCTGCCGGAGCT
GATCGTGGCGAAAATGACGGCTATGCAAACGTAACGAATTCCCGTTTCGACCGCGTCGACAAAAAGCTGCTGCAATTAACAGCTCGTGTTGAGCAGCTGG
AGAAAAACGGCGGAGAAAGTGTGAAGTAATTGCCAGTGCTTCTTGGGTATTCTGAAAATGTTGTCGAGAGATTTTGACCGACTTAGAAAAGCAAATTTGC
CGTGATCTTCTAACCTGACGCCTTCTGTATCTTCAATCTGACGCCTTGATTGATATGCTGCAGTAAGGGAATACTGGCGAGTCACAGGCCTTTGCTTTTG
AGCTACGTCTGTTGTCCCGCCGAGCTACAATGCGGGTGACAAAAATATGTGATCGTAATAAGCTTGTACGGATTATTATTGAAGGACAGCGAGTATTGTC
TTAGCCTTTAGGAACTTGTGTAAAGCCCTCCGAGAGCGGGACGCGTAAAACATCTCCAACCTGTGTCCAACTTTATTTCCAACTACACAAATACACATAA
TCAGTTATTTTTGAGTCGTGATTTGCTTTCGATTTGTAGATGACAGATGAGAGCCGTACATAACACCGTATCCTGCGCCAAGTAAAGCTCCAAGTACGCA
ATTAATATTCGACGGCAACCACGATCCTGCTCGCGTCCCCACTTATTTCTATCGTAACAGAACTTCACTCGAGTATTCTGTGACCTTGGTCTTTGTGACC
GTCTCGCTCCTTGTAGGGGTAATTTCATCTGGCGACCCTACGTGCAGACTAGCGCCATTCATCTCTTCATCGGGAACTGCACCACCCCATATCCACTCAT
AGAGCCTGGCGGCGGTGACACGTCCAATGTCAGGCTCGTCAAGTTCTGTTACGATAGAAATAAGTGGGGACGCGAGCATGATCGTGGTTGCCGTCTATAT
TAATTGCGTACTTGGAGCTTTATTTGGCGCAGATACGGTGTTATGAACGGCTCTCATCTGTCATCTATCAAATCGAAACAAATCTCGACTTCAAACTAAC
TGATTATGTGTATTTGTGTATTGGAGATAGATTTGGACACAGGTAGTCTATCAATTGGAAATGTGTAACGCGTCCCTCCATAGCTGCCTTGTGTTCTCTC
TTACAATGCTGCACACGTATGGCTACTTTTTGCTATATTAAGGTTATATTGNNNNNNNNNNAAGTTCTGTTACGATAGAAATAAGTGGGGACGCGAGCAG
GATCGTGGTTGCCGTCGAATATTAATTGCGTACTTGGAGCTTTACTTGGCGCAGGATACGGTGTTATGTACGGCTCTCATCTGTCATCTATCAAATCGAA
ACAAATCACGACTCAAAAATAACTGATTATGTGTATTTGTGTAGTTGGAGATAGAGTTGGACACAGGTAGTCTATCAGTTGGAGATGTGTAACGCGTCCC
TCCGAGAGCTGCCTTGTGCTCTCTCTTAGCAAAAGCTGCACAACGTATGGCTTACTTTTGCTATATTAAGGTTATATTGCAGTCCTGCAATCCAAGATAA
TGGTATCAGAAACACAAAAATGAATAGGTCCAATTTATAGATGACGCGATCAAAAAGACAGTTTTGCAGCGCGTGCAAACTCATTGGTCAGCCTTTTTCC
TCCTTCCGCTTACAACGTTGGAGCTCAAACGTCCAATCCCCGTAATTCTCGATAATTCTTTGTGTACATGTGATGTGTCTCAAACGGCAAGTTCTACACT
CCCGTCGTCAGTATCCAATTCGACACCAAGAGCTCAAGAGTTTTCAGACAACATGGGACGTTCCCGTTCTTCACGTCCTGCCGCCCGCCCTGCCCCCCGC
CGCGCTCCTGCACCTGCCCAGGCTCGTCGATCGGCACCTGCTCCGGCACACAAGCAAGCAGCTCCTGCCCCTGCACATCCAAGCAGCAGCGGTGGCGGTA
TGATGAGCGGCCTAATGAGCACGGTGGCTCAAGGTATGGCCTTCGGAACAGGCAGCGCTGTCGCTCACCGTGCTGTGAGCGCCGTTGCTGGCTCGTTCTC
TGGTGGCGCGGATACCCCGCAGCAGCAGCCGGAAGGTGCCTCGACGTCGCTTGACCACCAGACCGCGCAGCCGCCGGCGCAGAACCAGTGTGGCGCTGAC
CAGAAGGCTTTCTTGGAGTGCCTGAACTCGAGCAGCAACGACATTGCTTCGTGCCAGATGTACCTCGACCAGTTTAAGACCTGCCAGATGCAGCAGCCAA
GCACCTTCATGTAGATCCGCTTTCTCTTGACGTCGACGCAGGCGTTCAAGCGTCAGCAAAGGCAATCGGCGAAAGCGACGACACCGACAAGGTCGTGGTA
TAGCTACTGGACGCTGGTGATGGAAAGGCGAGTGTAGCAGAGAACTTGCGGTGGAGCAGCCACTAGACACTTGAGTGAAGTGCGTGTGAGGGAAAATGGG
CTTCAGTTTTCATTTTGTTATTCTCTGCAGTGCCGGACCTCTCGTTTACTATGGGGTTGACTGCCTTATTGCGTTTTTACAGATTGCGATGGGCTGACAG
CGTTCTGTGAATGTCTCTGCACATTAATTGTCAAGAGGGTGACTTAGCGAATACGTCAAGCAGTCGATGTAGACCCATCGTAGCCATGTGCGAACGCAAT
AGGCACGATAGATTCAGACGAGCACGGAGCGACGAAGCTTCGTTTCGCTCTCGACTTTCGACAGCTGAAGAGCTAATTTGGACAACTGACTCTCTTTTAT
CGCAATAGAAACTCGATCTGAATAGG