Description :
From Genome Similarity Track
Location :
Scaffold_1022:8490- 9881
Transcript NameFunction/comments
g5446.t1ETI38003.1 hypothetical protein F443_16184 [Phytophthora parasitica P1569

Sequence
1391 bases(100 bases per row)
GGTTGAGCGGCTCACCTTCGTTATGGCCACCTGAAGCCTTCCACCCGACCGGGTCCAACCTACGCGTTACGATGACTCGTTGTCCTTCGTCTCCAATCGC
AGTCTCTGTGGAAGTTCCTACCTCCGTTGATGATCAGAGCTCCAATCGAGTGGACTGTCAAACGCACACGGAGACGCAAAAAGGTTTACAGCAAAAGGCA
AGACAAAAGCTTCGAAGCACCTACAACCGAGAAGTGCAGGTCGAACGGGAGGAACGCTTGGAAAACCAGCGAGATCTCGCTCAGTGGCAAAGCCGCACTC
TTCATTTTGTCCCATCCTCTGAGCTCGCTGCGCATCGAGAACAGCAAAAAGGGGACCCGCATCTTCGCCATCGACGTACCCAAGCCTCGGCCATAGTGCA
GACACCAGGGTATTCACCTGAGAAGCAGCGCAGCAAAGAGTCCAGAGACTTGAAGGGCAAGCGGTTCAAGCTGCGTTGGCGCTCATTTTCAAAGTTGCTT
GACGTAATGCGACGAACGCCTTGTCGAAGGCCTGTGCTACAAGATATGGAGAAATTATTCGCCTTGTCCAGGGAGCTGTGCGCGCTCAATGCGCTCGGAA
CGTGCATGCTCTCGCGAGCTCAATTCATGCTGCTCATCACGAGGGAGTTCCCTTTGTGTGATGCCAAGCACGTGAATCGCTTGTATTCGTCGTACGACTG
GCAAATCTGTGACTCAGTAGATGCTCGATTCGTTCTTGGGACGATGAGAGCAATGCGTGTGCAACAAGGTGAGCCGATAGAGCTCATCTGCAACACGCTC
CGTGATTTTGACGACACCACCGCCGCCAACACAAAACTTTCAGATGACAAAGCTGTGGTCTCGAACGGTGTTTGTTTAGCGAAGGCTCTGTCGCTTTGTT
GTACCAGTGATGAGGAAGAGCGCGAAATGGAGAGCAGAGCCGACCTCATTTGGACCAAGACACTTGCCTGGCAACGACAAATTCTGTCGCGACGTCTGCG
CGGCGGTGTCCGACTCAATGTTTGGAAAGCATCAGGGATGTCGCTTTCGCGGGTCTCAAGCTCTGATAATTGCAGCCAAGATGCCGGCGTAGCGAGCAAA
GTAAGAGACTGTGAGACCAAGGAAGACGATGGCGAGGAGGACGTAGAGGACAGCAAGGAGGAACTTCCTGAGCTCAGCCAACTAGTAGATGAATCTCGCG
TACCTGTGCGGCGTATCCGTGAGGCTCTCAAACGAGAGCGAGAGACGCTGACAATCTTCACTCAACAACTTCTCCAACGCAGGCACGAGTGTCTTGTTGG
TGCCAGCACGAGTTCTCCGAGGCAGTAATCTCACGTGTTTTGGTTTCACGAATCAACATCCTTTGCATCTTTTTATTCACGTCTCGACGAT