Description :
From Genome Similarity Track
Location :
Scaffold_152:8490- 9624
Transcript NameFunction/comments
Phypl_g4276ABC transporter lipid exporter ABCA1 family

Sequence
1134 bases(100 bases per row)
AGCGCGGCGAATGCTTCGGATTCCTCGGTATCAACGGTGCCGGCAAGACCACCACTATGAAGATGTTGACGGGTGACGTTCCTCCGAGCAGCGGTACAGC
TACACTCGGGGGCTTCAACATTCTCCGGGAGCAAATTGAAGTGCGCCGCCAGATCGGCTACTGTCCGCAGTTTGATGCTTTGTTTGATCTGCTCACTGTG
CGCGAGCACCTGGAGCTCTTCGGTGCTATCAAGGGTGTGCCGCAATCGTCAATGGACCGTGTCGTCATGGAGAAAATTCGCCAGCTGAATCTCAGCGACT
TCGAGCACAAGCTGGCCGGCAGTCTCAGTGGTGgcaacaagcgcaagctgtcggtggccatcgccatgaTCGGCAACCCAGCCATTATCTTCCTCGACGA
ACCGTCCACCGGTATGGATCCCTGTATCTCGACGATTCATGTGGGACGTCATCGCCGACATTTCCACCCGTGGCAAGGAGTCGACAATTGTACTGACGAC
ACACAGCATGGAGGAGTGTGAAGCACTGTGCTCACGTGTTGGCATCATGGTCGGAGGTCGTCTCCGCTGCTATGGAAGTGTACAGCACCTCAAGACTCGG
TTTGGCGACGGTCTGATATTTGATGTGAAGCTTGACACGCCTACTACCGAGGAACTCGAGTACCTTTTCCAGCATGTCTTCGGTGACGGCAACACGTACG
TGACGCAAATGGAGCTGGAAAGCAAATGTCGCGCGTTCGGCAACGTCGAGCTCGCGGAACGTATCACACCTTCACACCCAACCGGCTACAGCCTTGCAGC
TGCAATGGAGCGTGACGGATTTATCCGTGCGGAGGCGTTCTGCTCCTGGTGCGTCGAGGAAACGCGCTTCGACACGTTGAACGACTACCTTCAGAACGCG
TTTGGCCCAGGTGGTGTCCTGGTGATGGAGCGCCAGAACGATTTCTGCCGCTTCAAGGTTCGCGGATCCAACAACGATGTGAAGCTTTCCAAGATGTTCG
CGCTGATTGAGAACTTGAAGACCGACATGCACATCCGCGAGTACAGCGTCTCAcagacgacgctggagcagatcttCAACTCCTTCGCCAGCCAGCAAAA
AGAAGAGAAGGGCGTCGCTCGCGGTGCCTTCCAG