Description :
From Genome Similarity Track
Location :
Scaffold_720:8489- 12574
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_720-snap-gene-0.10Cullin-associated NEDD8-dissociated protein
Pytiw_DAOMBR242034maker-piw_contig_720-fgenesh-gene-0.2Serine/threonine-protein phosphatase

Sequence
4085 bases(100 bases per row)
CCTTCTTCCTCGCGCTCGCTCATTTTCTTCAGCACTGGAAGTACACGGGCGACGTAGACAGTAAATCCGTGCTGTGGGCTCGCAGCGTGGTCAGAGATGA
CTTCACGCAGCGAGCTCAGCAAGAGGTACGAGTTGACTCCTTGCTCGATCTTGTGCATGATCGTCTCGAGGTACTCCTCCGTGTTGCCCACGCAGATACT
GCCAAGCGCATAAGCTGCGGCCGCCTTCACCTCTTCTCCATTCGCAGAGAAATTTTGCAGAATAGTCTCCTTGACATCCGCGTACCCCTTCAAGTTGATC
TGGCGACCGAACTCTCCAAGACTGTAGAGCGCGACGACCTTGTTCTTCTCGTCTGCGCTGCTGATATCTCCAACAAACTTGGAGAACGCGGACTGGCGGT
TCGCCTCCGACGTCACGACGCAGGTGGCAGCAACGCAGCGCGCGAGGTTCAAAACCGAGTGCTTGGAGAGATCCGATGGAGAGTCCATGAACGCGGTAAA
CAAATCCGTGAAGCTGCTTCCAGGCAAGTTGAGCTCCGTGAGCTGAGCGAAGAATCCCTTCAGCGCCTCCAAAGTCGGACCTTGAAGCATGGAGCTGCGG
CAGAGCGAGATCGCGTTCACAAGCGCCTTCTGCAGCAAAGCGTCCGTCGACGCAATCGTTGGCGATATGCGAAGAGTGTTCGAGATCAAGACGATACCAG
TGCGGCAGAGTTGAAGATCGCTGTCAACCACGAGGTACGAGGCTTCCGAAACCACGTCGCAGAGAAGCTCCTGTTTGATCTGGGCCCCCTTGTGAAGCAC
CAAGTTGTTCAGCGCATCCAGCGCCGCCTGTTTCAAGGTTCGCGACTGCTGACGAAGGAGCTGGGAGAGCGCGACGATGCATTCCGACAGAATCGAAGAC
ATGTCGATGTTCAGCTTGGAGCGCGCGATCACAGCAATCGCTTTCATGCTCTGCACACGAGTGATCTCGTTGTTGAGACGTTCCATAAGCAACGGGAACA
CTTCGTCGATTCGAGAGCTCAGTTCATCACCTAAACATCAGACACATCATGTGAGCACTCATATTCTCTGGTCAATGAAATAGGTACACGAAAGTCCAGG
CACGTACCGAGTTCCGCAACGATTTGTCCGATGCTGCTAATCGCAGACTCCTTGATTTCTTGGTCGATATCGTGGGCCTTCAAGCTCGGGAGGACGGCTT
CGAACACCGCCACGGCGTGGCTCTTGGCAGCAGCATCGTTGATCTCCGAAATCACACGCACCAGCGACTCAATCAAACCCAGCGCTTTCGCCACAGTCTT
GTACCAATCACCCTTGGCGCAGTGGACTGCAGCGCGGACAATTGCACCGATGTGTGCACGGAAAGGTTCGGCCGGGTGGGTGTCGATGAGCAGTCGGAGG
AACACGAGCGCATCTAGCTTCAAGTCGGAGTGCTTGTCTTCAGCCGCGCGAATGATGTTTGGCAACAACACGTTGATGTAGTCTCCAAGCTGACCGCGTT
CCACTGTCGCCAGCTCGCTCAGTACCGCAATCACAGCGCAGCGCGGCGAGACAGACGCTTTCGGTCCAAACTGCTTGTTCGCAGAAAGGACGATCATTTT
GAGACGCGCGCGAACCTGCTCGAGGCACTTATTCGACGGGTGTGCAGAGCCAGCATTCGGAAGAGATCGACGAGTTGCACGAAGCAGTTCTGTAAAGACA
GAGAACACGTCGATGCGGACGTTCTCCTCACGCTCCTTGAAGCGCGAGATGATTTGCTGGCTGTAGTTCTCATACAGGTGCTCCAGCAGCTCTGGACGGG
ACGAAATGATCGCCGTGAGCACGCGAAGCCCTGCACGACGAACCTTCCAGCTGGTGTCATCGTCGTCACTGTAGTCGCCATCGTCTTCGTCCGAGTACTC
TTCTTCGTCTTCATCCATTGGCTCATCGTCGTCTTCGGAGTCGCCGTAGTTGTAGTTCGGGTCATACTTGATGAACTCCATCACTAACGTAAGGATGCTC
TGCACGTGTGGCGTGATTTCGTTATGGCATCGAATGACAAACGACTCAAACGCCTGGAAGCAGTTCTCACGGAGCTCGCTGGACGCTTCATTCTGCAGCG
ACTCGTCGTCTGGTTCACCGCAAAACTTCAGCAAGATCGGAATGATCGCGTTCAAGTGCTGTCCCAGACGGTGGCCCGCAGTGCGTGACAGCGTACCGAT
CGTCTGGATAAACGTGCGCACATCGACGGAGCCGCTCGACGCTTCGATTCCCTTGATCAGGTGCTCGACAAGACGCGTCAGCAACGCATCAGACGCCATC
ACGCCCAGCGATCCAACACACGCAGTCGCACGCTTGCGCACGAGAGGTGACACGTCGTTCAGCTGCGTGATCAAGATGTTCATAATCGTGTCATGCTCCG
TCGCGATGTCGTGGCCGAAGCGACGCAACAGGTCCGTCAAAATATCAAGGGTCTCCGACTTCACTGCCTGGTCTTTGTCTTGACCAAGACCCTTCAGGAG
ACGAGCACAGAGCCCCGAGGCAATAGCCGCGCCAGTCTTCGTCGAGACGTCCGTGAGAATCGTCTTCAGTCCAATCGAGTAAATATCGCGCAGCTCAGAC
TTTCCGTTCAGGATAAGATCGCTCAGCTTCGCGCAGATGTCGGCCACCTGCGTTTCCTGCACTTTGGTCACCAAGATGCCCAGACTGACCAGTACGAAGC
ATACGAGTTAGCTTTACTGTTGGTCCCATGATCGCAAGCTTGAAAAGGGGAAAAAATACGCACCATTTCACAGCGATCGACTGCACGTCGTTCGACTTGT
CGTCCAACTGCTTCAGCACCGCAGCGCACACTCTGTAATAGCAAACGTGCAGATGGAAATGCGTCGCGCAGTTATATCCTCACAGTCAGCACAACAGCTA
GTGAACGGCAAGGAAGACAATGTTGCAACTTGGCGCGCACGTACTTTGGTTCAAAGTACGGACCCAGTTCGGTGTCCTTGTTGAGCTCGTTACAGAGGTC
CGACGTCGCCATGTAGCGCTCATCCTTGTCGAAATCCGTAGTCTAATGCCAGCAGCAGCAGCACATTGCATGGTGGAAAGAAGTGTACCCAAAGCGACAT
GGTTAGCAAAAAGAAAAAAAAATAGATCCACATGTCGTGACGGCCCAACTGCAGAGCTGAAAATGAATACAACATGCATTTATACGGGAGTAGAGGGAGC
GTGACGACCGCAACCACCCACCGTCCACTGCACGCGCACACACCTTGTCCAGCAGGAGCGCGATCCGCTCTTCGTTGCCCGGCATGGCTCTCTTCTCTCG
CTTTTCCGCAGCTTCGTGAATGATCTCAGTCAGTCAAGGAAGGGAGGTGCAAAGATCCGATATTACAGTGGACCACATAAAAACAGGACAACCATCACTC
TGAAACGATAAATTACCGTATTTACTGTGCACCACCCTATAATTTGCACAAATTTGCCTATTTTGATGTGTATCACCTTATTTCGTGATACGCCATCACT
CCGAACTTCAACTCGAGCGGCGCCATTATTAATAGAGACCATGGCAGCAGAGCCACTCAGCAGTGTGTTATGCAGCAGTGCGCTCTCTGGTACCTATCTC
TATGCATGGTCTGCATGTGCGTGGCTTTGAGAGGCGTTGAAACGCTTTCGCTCGTGGACCGATCCGCCTCCGACAGTGGCTGTGCCCACTGGGACCGAGC
CAAGCTAAACCCGGACGAGAGCTCACTCGACTGGATCTCTGAGCGACTGACAGCCCGGACTCACTTCAGAATTGAAAGAGAGCTGCGTGGCGAATGAATC
TCGGCCACCACCACATCGCTTATCATGACCAGAAGCAACGCGAAGCGGCACTCGTGCTCTACGGAGACGCGGCGCACGATCACGTCCCAAGCCCCGAGCG
GCGCAGCTCGTCAGACGTCCAGACCAAGTGCTACCACCAGTTGTGCTGTGAGCGTGAACGCCAGACAGCTCGAGAAGTGCAGGTACGAGGATGTGATCTT
TAATGCCAGCTATGGTCTGCTATTGATGGTATCACTGTGTATGCAATGCTTGTGTGACGCAATGTCAGAAACTGCGTGATTCGTT