Description :
From Genome Similarity Track
Location :
Scaffold_78:8487- 13557
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_78-snap-gene-0.12TATA-binding-protein-associated factor 172

Sequence
5070 bases(100 bases per row)
GTAGAGGGAAGCGATGCGCAAGTaCGGGAAAATGCCGCCGAAAAGCTCGGCGAGATCGCCCTCCACTCGCCCGTGtATTGCCATTCGATCCTACAGCAGG
TGTGTACACCCGTGAATTCGGACTAGCACCTCATACAGGAGCACTCACGGCGTCCTTAGGTGCGTGGCCTGCTCGTACATCGTGAATGGGACGTCCGTGT
GGCCGCTGCCAAGTGCTTGGCGGTCGTCGCTCGCTCCTTGCGTTCCTCCGGCCGCAGCGTCGCGCTTGCTTTCGCCCAGGCTTCCTGTGCGTCTCTATCT
CGCTCTGTATGTGTGTTAGTTCTCCTACTGACGTCATGTATGGTCCAGTTGCCGGACGTGCGGCCTCATGTCCGAGACTCAACTTCCGTACCGTGGACAT
GGCGGTCGTGCTGCGTGATGGTACGCCCTTGCTACGCAGTGGCGGTGAAGAGTATCAGTACCAGTCCAATATCAGCGACGAGCAGCGGCGCCTCCATGTC
GTGCGGCAGCGACAGTTGCTCCTGCGACGCATCTGCGGCGTATCGGGTGATGGCCTGTGGAAGACGACGGAGGACTCGCTGGCTCAGCAGATGCTGCCCc
GCcTCAATACAGACCGTGCGTTCATCCGTATTGGTACCCGTGCCAATGAATAGTAAGGGCTGACGCTCGACGGATTGCTGTAGACGTCAAGGAACTGGCC
GATGACATCGAGGCGAGTGAGTCGGCAGTGGAGAAGCACGAGTTTCCCGTCGTGGACGAGCAGCGTAAGCGAGCCCGAGACATGTTGCCAACACAAGAAC
CAAACACCAAGAGAATCAAAGTCGAACACGAAGAAGAGCAGCACTTGGACATTGTGGCCCGACTGGCGATCGATCTATTTGAAAGCATCTTCGACGCCAA
GTGGGAGGTTCGCCATGGCGCATTCGCGGCACTTCGACATATTTTGCTTTCTTCAGGTATGATGCAAGCACTACAGAAGGCAGCACGAGATAAAGATAAG
TCACCGGACGCTCAGCTGATCGACCAGTGGATCGAAGAAAGTCTCATGCGGTGCATGTGCGTGCTGGCGTTGGATCAGTTTGTCGACTACTCTGCCGACG
GCTCCGTAGCGCCAGTTCGAGAGCTAAGCGCCCAAGTGTTTGGGATTTtACTCGGTAGTTTGCACGAGCAAGCACTTGTCCAAGCGTATCTCGTGGTACT
GCGGAAACTGCTGGAGAAAACGAGTtCGTGGCATGCTTCTCACGGAGGATTACTCGGTATCAAGTACCTCATTCATGCGCATACATTTCATGCGACGCaT
CTTGTGCCGCTTGTAATTCATGACGCAATTGACACTCTCACAGCTGAGAACGACGCGTCGGAAGAGGATCTCGTCGTCGTTGCAGCAGGCATTCTAGGGG
ATGTGGTAAGCTACGTTGATCGCGTGGAGACTCCCACAATCAAACTTGCAGCCCTCGCATTGTGGGGTATCgTCACCAAGTCTAGCAACCGAGATGGTGT
CGTCATAAGCACAACTGTGCAAGCGCTGAAGCTCTGGTACACACGAGAACGAATCGTGAACGAATTGTCCCAGCGACTCAACGCGGCATCAATGTGGAAT
TACATCCTCCAACTTGTGCCTTTCATGCATCACAACAGCCGCGACGTTCGCAACTCGGCTGCGGCATGTATCGTTGGCCTCACTTCATCGAAGGCGCCTG
CTGCCCCTCCAATGATCGTCAAGTCTGCCCAGTGCGTGCTATCTCATGTGCTGCTTCAAATGCTCTGTGAGACAGATGAGGCCGCGCTTGAGGTGCTAAA
ACGCTGTTGGGAGGCGATTGTGGCTCTGTGTGCTACTGAAATTGTGCTTCTTCGTGCTATCGAGCCCCAACTCGAAGGTTGGATCCAACTCCTCTGGTCG
TTTGAAaGTATCGGCGTGCTTCAGATTGCTGTGCCAGGACGATCAGCAGCAGCACCAATTCCAGCTCCGTCAAAGAACAATCTGCGTGGTCGAGCTGGGT
TCGCCGATGCTCTCGGGTTTCTCGCCTCTTACGTTCCAGTCGGAACGAATGCCTTCAATTGTATCGTAAAACACATGATACCAGCCATCAGCTCAGACTC
TGGCGACCAACAGTGCGGTTCGCTGCTGCTTCTAGCCCGATGGAGTCATTATGCCAAACTCGAGTGCACCCCAAGCTCCATTGATGCCATTCGAGCTCAT
GCTGGTGAATTGATTGAGGCACTTGCGCGTAACGATTGGATACCGACTTCAGGAGCAGGATACTTCTACACAGAACAGAAGCAGTCACTGCAAAGAGTCG
TGCGAATGCAAGCGCATCTGCGCCAGATTTTCACTGCAGGGAACGTTCGCAATTTACCTCCGGCGATAGTAGTTGATCCTGACTCGACTAGCCAGTCGAT
CGCTCAAGTTTCTCGTCAGATCGCTGAGTGTGTTGGACAATACCCGTATGACGCACTCAAAGGTAaTCCTACCGCATTTGAACAGGCTCATTTTGCCcGG
CAAGACCTCTTtCTCGTGGACGAAGTGATCCAGCAGGCCTTCATATCAACTTACGCAAGAGTTCAGGGCATTGGAAGTTGCGCGTTCTGTGAGCTGTTGC
CGATCCcGACCAAGAAGAgCGGGTTCCTTGTCAAATCGTTGATGGAGTCGATCAAGAaCGAAGGTGAAGTCGTCTTCCAGGCCCTTGCCGCTAACACTAT
GGCCCAGTTTGTCGTATCGCAAGTTGATTTGCAGCAAAAGTGCGTAACGAAAATCGTGTCGAATCTCTGCAATAGTGCTGTCGCATTGGCATACCATGAA
CGTGAAGAGTCGACTGCTGATAACAACAAGCCGCTTGAAGACGATGCCGTCGATCGCAAATTGCAGATACGAATCGAAGGGGCTGTCAACACGCTACAGG
CGATCACACGAGCGGCCGGACCAGCGATGGAGAAGTTGCCACTACTGAATTCAATTGTCACTCGCGGATGGAATCTTACAGCAGAAACGAAGTGGAGTGA
TCGGCTTGTCCAAGAAAACGCACATCTTGTCACTGTTCTCGCCTCTGCAGTTAGTAATAGTCACAGTGCGCTGCTTCTCGAGTGGATACGTGCACTACTG
GCTATCGTCGGTGAATCGTTTGCCGTGGAGCAGACACGACGAGCTGTCGCCACTGCAATCGCCATTGCAGCTCGATGTGCGATCGAAACTCTCGGAGACG
AGCAAGTGATGGTGCTACTCTATGAAGAGCTCTTCTCTACAGAGTTCGAGTATGGAGGCGACAACATGCTCACCGGTTCGATCATGGTGCTGAACCGCTT
CGTGGTTGAGGCGGGCAATCGGCTAACTCCTTATGTACCAAGTTTGATCCACTTTTCAATGCGAGCGATGCATGCACCCCTTCCACTTGTACGCTCGATG
GCTGCCAAGACATTTGCGGATCTCGTGCCGTTGCTGCCGCTTCAGATGGATCGTGGTGCATCGCATGATGTTTCAAACTCACGACTGCAGCGTATGCTCC
AAGaTAATCAGTCTTCACGTGGGTTCCTGGAACGTCTTCTTCAAGGAAAAGCCATTGATGAAGTCGATACCAGCCATGTTTTGTCTACGCGATTTCAATT
GCGGGAGTACCAACAGCATGGCGTCAACTGGCTGTCGTTCCTCACACAGAATCGCATGGGTGGCGTGCTCGCAGACGACATGGGACTGGGAAAAACTATC
CAAGTTCTCGCGACGATCGCCAGTCACTCAAGAGTGACAAAAGCAAAGCCGTCACTTATCGTGTGTCCACCGATCGTTGTCCACCATTGGCTACAGGAAG
CCAAGCGGTGTTTTCCAGATAGTTTCGACCACGTTCTTGACTATACGGGCCCGGCAGCCACTCGGAAGGCATTATTGAGGAAGAAGGAATCAAGCTGGAA
GCTCTTGGTTACAACCTACTCGGTTGTTCGAACCGACAAGGAGCTGCTCAGCGCCACACCATTCGAGTTTGTTGTGCTTGACGAAGCCCACCTCATCCGC
AACCCGAAATCCGCGCTTTTCGAGGCTGTGTGTACACTCCAGGCGTCGCATCGCTTTGCTTTGAGCGGCACCCCACTGCAAAACCACGTCGGTGACTTGT
GGTCGCTCTTTACTTTTCTGATGCCTGGATATCTCGGTGAATACGCCGAGTTTCGCCGAGACGTAGAGCTTCCGATTTCTCGATCTCGAGAGCGTAATGC
TACGCCAAGaCAAAAAGAaCACGCTGCAATCGCGATCGACCGCCTGCATCAGCGTGTACTGCCCTTCATCTTGCGCCGCACGAAGGACCAAGTACTCAAG
GAAcTACCCCCcAAGATCATCTCCAACATTCTCTTACCTCTCACCCCGTTGCAGCAGCGTCTGTATCATGCTGCGTCAGGTGGAGATGGCCAACAACCAT
CGGAGCGCAAGTCCACGCTACCGAGTGTTCTTCAGAACTTGCAGTTACTGAAGAAGATTTGCGTTcACCCGGCACTCGTTCGTGACGAAGCAGAGCAACT
CCTTGAGGGATCGAGCAAGAAAACCATCGAGAAAAAATCGATTACTGACTGGAAACAATCCGGCAAGATGCTCGGACTGCGCGATTTGCTGGTGGATTCC
TGCGATTTGGGCCGCCCAGACGACGAGAATGAGGACAATGGTGCCTGGATAGGCGGTAGTCACCGCTGTCTCATCTTCGCCCATCTTAAGGAGACTCTCG
ACCTTATCCAGGACATGTTCGCTCAAGCACTTCCTCGTTTGGCATTTGCACGGCTTGACGGACgAACCCCcGCGGCCAAGCGTCACGATATTGTCACCAA
GTTCAATGAGGACCCATCAATCGATGTGCTGTTGCTCACGACTGCAGTGGGAGGATTGGGTTTGACTCTCACGGGTGCCGACACGGTCATCTTCATCGAG
CATTCATGGAACCCGTTCGTGGATCTACAGGCCATGGACCGTGCCCACCGCATCGGTCAGACACGAACTGTCCGCGTATTTCGTTTGATCATGGAAAaCT
CcTTGGAGGAGCACATCATGGACCTCCAGGCCTTCAAGGAGCGTGTGGCCAGCACCGTCGTCACGAACAC