Description :
From Genome Similarity Track
Location :
Scaffold_1:84860- 89486
Sequence
4626 bases(100 bases per row)
CTTCCCGGTCAGCATCGCCAAGCGTCGCGCTAGTCGGTACCTGGGCGTCTTCTTCATCGGCCGTAAGCAGCGGTGATCCCGGGCAGGAGCCCGGAGAAAT
TCTTTCTCCGGCACATACGGCTCGGTATGATTCGTGGTCTTTGTGATCTTGATCTACTTTAAAATCCGTATTTACTCCATTTTCCTCGCAAAGGTGAGAC
AGGAGCTTGGTATCCAGCGATTTAAGATGGAACTACCCCGGGCAATCTTCTTGGCGCCTTGGCGGTCGCAGACGAGGCTGATCGCTGGCTTAATCACTAC
CGTACCGTGCCAGTCGACCACCACGCACTTGGGATCGCACATCTGCCAGGAAAGTTCATGCCGGCCCTCCCACAGTCGCGTCATCTTTCCAGCGTCAACC
CGTAGTCGTGCTAGTAACCGCGCTGGTGGAGCAGGCCAAGTCCATCCAGCCAATATATGTCCCACTTTGTATCTCCAGATATCTAGAGAGTTTCTTTCGC
TCACATCATTTTCGTTTGGCCTAATCCAACTCCCTGTCGGACCTTCTCCGATTGGTTGCTTCTCGTTTATAGGCCCACAGCACGTTACGAATACCACCTC
CTTCTCGAAGCTAGCAACCACCCTGCAAGTCAATCGACCTCTCGCGTCTCCGCCATGGCCAGCCCACCGCAGATGTTCCACCGCCAACGCATCGTGAGAC
TGCATCGCCCCGAAACGGTTTCGACCGGTCCGTCTACATTCGAAATCTCTCAGCAGTGCTCCGCAATTTAGGTCTGCTTCGTCGATCCGTGAGGGCTCCG
CATATCCCGTCCAGTATACCAGATATTCACGTAAGGCGCGGCCGTAGCGTGTCCGCCGTCCTGTTCTCACATCAGCGATCCGCTCGACTTCGAACTCGCC
TTCGTCTAGATCGCGCTCCCAGCTGTCCTCTGGTAGCAAGCCTCGTCGAAGTCTACGCGGGCGGTCTTATCGTCCGTCGGCGTGGTCCGGATACGTTTTG
GCCAGATTCAGCTTTGTCATATGTACGATCGGGAATAGTCGATATTCAGTGCCGGCAGTCTCTATTCTTGCCGCATGCCGATCGATCATTTCCGCGACTC
TGAAGGGGCCGTGCCACATGTGCGCTAACTTCCTAGCGTAACCTTCTTTGACACGATCTAGGTATAACCACACCTTGTCACCGAACTGGATGTCATGGGG
CCGCACATTCTCGATGTGTCGATCTGCTCTCGCTGTAAAAGCTTCGCGCAGAGCTTCGTTGACCTGTTCTCGGGCCTCTTGGTACTCTCGCTGGGTGTTA
TAGCGCCATCGGAGCGGCTCCTAGTCCTGGCGTCGTGTGCTGCCGAGTGGAAGTGTTGCTTCCAGGGTGGACCTTACGTCCTATCCGTGGATCAGGTAAA
ACGGCGTCGCTCCGCGAATTCGGTCATATGCCGTGCTAATAGCGAAAGTCAAACGCTCCGGGTACTCGTCCCAGTTCTTCTGATCTACATCTGCGACATA
CATCTTCAACGAGCTGGTCAGCGTCTGCACCATCCATTCCGCTGTGCCGTTGTCCTACGAAACGACTGAACGCGCCGAAAAAAATGAGACATGAAACCTG
TCTCCCGATCGTACCGGATAACTTCGCTCGCGCCGAAGCGGCGGAAGACACATTCTTCGTAGCTCTCGGCTATCTTCTGCGCCGTTCTCGACGCACTTAC
CTTGGCTACCACGTAATCTAAAAACAGGTCAACCCAGATGAGCAGCTCGGTATTGCCCTTGTGTGACTTCGGTAGAGACGGGATATGGTCCATCGCGACA
CATTGGAATGGGTACGTACAGTAGCTTGATGTTTCCCAGCGATTCTGCTCGAAGTGTCGGAAGTCCTGTTCCTGTCTCGCAATCCGCACACTGTCTCACA
TAGCGCTGCACACTCTTGAACAGGCCGCGCCAATGGAAGTGCGATCTCACCCGTTGGTACGTTCTTCCAATTCCTTGGTGACCGAATTCCAGGCTTTGAG
GTAATGATGAAGCACGTCTTGTTGTAGATCTTCCGGCACTACCAGTTTCGCTACTTGGTCGCGGTTAACGTCGCCTCCCCGTGCGTTCGGGCAATAGAAG
AGTAGGCCGTCCTCGCCGGCTTGTACTCGTCGGCGATTTGGCTGCAAGTACGCGCCTCTTCAGCGCTTAGCTTCTCCAGATCACCCAACCGGTGCGTTTT
TAGATCCGCGATCCACTTCTCCTCGTTCTGTGCTTTCCGGATTCGATCTGTTCTCATACGTTATACCATACCCAACCGTATCACTTTCGGAGTACTCGCA
AGGCGCGTCCGTAGTCGTGTAGCAGCCGCTACGCATACGGCCTACGGGAGCAACAGTTTCGGCAGCCGGTTGAGATCGATCAGGTCTTCTGAGTTTATGT
CCGAGGTAACTACGGTATCTGCTTGTTCGCGTAGCCCGTCGCTTGCTAGCCGATCTGCACTTTGGTTCCATTATAGCTTTACATGTAGGAATTCGTGTGA
CGGCCACGACCTCAGTCGATCCAGCGCCCGCTGTCGCAGAGACGTCAAGCTGGGTGCCTTGCACTCGATCTCGCCGCGCATCTGCTTGATCACTAGGTTG
GCGTCGCCGCAAATGATCAGCCGTCCCCTGTCTAGGTTTGATAGTTGATTGAACGCCAACAGTAGCCCGTCGTACTCTGCCTCGTTTACCGTGAGGTCTG
GCGCATACTTTGTTTCCGCTGCGACCGCAATCCACTCAGGTAGCTTCCATACAATGGCACTGCTCGCCCGTCCGCCGCTTTTTCCACGCGCCGATCCGTC
AAAACTCACGACTAAAACCTCCTCGCCTTGCTCAACCGTCGTCGGGGTTGCGGCGATATTTGAACGTGGGCGCTTGCTTGGTGCAACCGACGACAAGATC
GAGTCGACGTTCTCCCGAGGGGTGATACTTGCTGCAATGGTGCCCAGAATTTCGTTCTCTCTGCGCGTACACTTGATAGTCTCTAGCGTCCACGGCGAAA
CCAATGCTGCTCAGTTGCCCAGCCGGCCCTGCAAACACAATGATCGCACCAGCCATGCTAGCGTGGAGTATCGCGTCAGCACCCTGCTCGAAAACCCGCC
GTTGACAACCCTAGGACTGATCGATCTCGTGATTAGCGTGGTGTAACACACGTCCAGTATCCTGAGAAGAGCCAAGATCTCCATCTCAACGGTACCGTAG
TTCAACTCATTGGACCTCAACGTGCGACTGGTGAACGTTACAGACATTTACGTGCCGTCGTGTTCCTGCATCAAGACCGCCGAAATCGCCCAATCACTCG
CGAAGACGACGATCACTGGCGTCCGAACGGGGTCAAAGTGTCTGGACACTGGTTCGTCTGCGATCTTGTTCTTCAGCTGTTAGAACGCTAGTCGCGCTCG
GACCAATTTGTCTGTTTCATCCGCCGAGGCGATCCGCTTCTCGCCCTCAGCAGCTCGATCGGGTTTCGGGTTCATTTCGTGAAATTCCACTTCTTGCAGT
TCATACAAGATCGACGCGTAGATTGCGAAATCATCAATGAATCTGCTGTTGTAGTTAAGGCTACCAAGAAAAGTCTGGATAGATCACGGTGCTCACGGGA
ATGGCAAAACCGTCAGAGTCTCGAGGTTCTTCGGGTGCGTTTCGAGGCCGTCCGCGGACACTCGATGTCCCAGGTAGTCTACTTGGCGGCAGCCCCATGA
TCTCTTCACCATGCTGATCGACAAGTTCCAACGGTCGCACGCGTGTAGCAGTCGATCGATTCTGGTGCAGAGCTCGTTCCAGGATTCAGTGGTCACCAGA
ATGCCGTCGATGTACGAGCGACGTCCCAGCACAGGCGGTCCTGAATGTACGTCTGGATCACCGATCTTGAACGCATCCGCCATACCTGACTGGTCGCCTT
CTTCGCGGATCCGAAGATAGCCATACAATGCGTTGTCCAGATGTCGCTGGTAGATTTGAGGGACGTTCTTCAACCCAAAGCGCATACGCAGCCATTCAAA
GAGACCAAACGGCATGACGAACGCCGACACCAAACGCACCCGCTGGGGTCGTCGACATGACCCAGAAACCGCTCGCCATATCTAACGAGCAGTACCAGAG
TGCCTTATCTAGGTCTTCCAACAGATCGTTGATCAACGACATGGCGTACACCATGAGACGTATCAGGCTGTTCACCACGCGGCAATCGATGCGGAGTCTA
ATGTCGACCCCATTCCTCTTGACAATCACCACGATAGGCGACACCCACGGCAAGCTAGACGTCTTTCTGATATGGGCAGACCCTTGATCAAGCCGGATAA
GTTATCTCGAAATTGCGGCGCAACTCGACGCACGCGCTGATCCACTGGCTTGGCGGTCCCAGTATCGATATCACAGTAGACGCCTCGCGCGGCTGGCGGC
AGGGCGTTCCCTTCTCCGAGAAGAAGATGGTGTCGGCTTCAGATGATATTCCCCAACCTAACTTCATCCGCTGGCGCGACAAAGTCCTCATACTCGATTC
GGACGTCTTCAAGCTTCACATTTCCTGGCGTTGTCGTCCCCTCTGGCAAGATTACCAACTGAGCGTCTACGCCTTCGACAAAGCGTTTGCCCCCTTCGTT
TATGCAGACTTGGTCAGCCTCCACAG