Description :
From Genome Similarity Track
Location :
Scaffold_32:84844- 87452
Transcript NameFunction/comments
Phyra_95122ATP-binding Cassette (ABC) Superfamily

Sequence
2608 bases(100 bases per row)
AACGTCAACCTGCGAGTAAACGAAGGCGAGTTGGTGGTGATTCATGGCAAGGCGGGGGCCGGGAAAACTACGCTGCTGACTGCATTCCTGGGTGATGTGG
CGTGCGTGAATGGCAGTGTTTACCTGTCGCCAAACTACAAGATCGCGTACTGTTCTGAGCAGCCATGGCTACAGACTCTCAGTATCAAGGAGAACGTCAT
TTTTGGTTATGCCTACGACGAAGCCAAATACTACCGTGTATTGGATGCGTGCTGCTTGCTGGAAGACCTTGAAAGCCTACCAAATGGAGACGACACGATG
ATCGGTCCGAAAGGCATTAATCTTTCGGGCGGTCAGAAATCTCGCATTGCTCTCGCTCGAACATTATACTCTGACGCGGATGTGTACCTGCTTGACCGTC
CATTGGCCAGTGCAGACGCCATTGTGCAAAGTGATGTGTTTCGCAAGTGTTTCTTGGAGCTGCTCCGGTACAAGACGGTTATTATTGCCACACACAACCC
AGAAGTTGTTGAATCTGATTTTGTCGATCGCTTATGGTACGTCAATGACTCCGCTGTCTCGGAAACATGTCGAGGTGGGTCGTCCTCGGCGGCGACAGGA
ACAAGCAGTCGTCGTGCTCGTCGCCTTGCAGATATTCCACCCTGGCGTATAGGCCACAGTGATGAAAATACCGACGATGAATACACCCCGTTTGCGATGG
ATAAACAGGAGATGGAGGGGGTGCGAGCACGGATATCGCGCCATCGGCCAGTACCAAAAGCGCCAGGAAGCCCCGAATGTGACCTGACACGCCGCACAAT
GGATGGAATTGCCAAGGAAGTTTGGTGGCCGAAGTATGACCGAAATTCTTCAATCATGGCTTGCATTTTCTTCCTCGCGTATGGCCTAATTGATGTGGCT
AAGAACTTGTGGCTGGTACATTGGAGCAATTTGGCCTGGACTTCTGTCGATATGTGGAACGCAACAGTCGTCTACGGTTTGCTCAGTGTTGGCGCTTTTG
TCGTCTTACTTTTGAGCTGTGCAGTGGTGTTTTACGCTCTTTCCAGACGCGCTAAAGGTATTTTCAGCGAAGTGACGCAGTCATTGCTGCGCGCTCCGAT
GTCAGTGCTAAATCACACTCCAATCGGGGAGATCCTGGCGCGGTACTCTACAGACATGCAAGTCATCGACGGTTTGATGTCGTTTCCTTTGGTGTTTATG
TTCCGAAGTACCGCATCCATTGCGGCTGCGTTGGGAACAATGTGTTATTTGTTGGGCGTCATGGGTGCAGTTTTCACAGCGCTGACGGTGTACTTGTGTC
GAGGAATGGTGGACAAGCGTCTTTTTGCTCAGGTCTATACGTTGAGAGCACAATTGGATGCGGCCGACCTGAATTTTGTTTCTGAGACTCTTGACGGCGC
TGCTGTAATCCGTTCATTTGGAGCTGATCAGATCAACCGCGTGTGTCAACACCATGGCAAAATGGTAGATGATAGGTCTCGGATTGCGACGGTCGTCGAG
GTATTCACCCACTGGTTGTACATTCGGTGCAGCCTTCTTGTTGCGGTCTTTTTGTTCTGCTTGGCCGTTTTGCTGGCGCATGGGGGTCTTCAAGCAAGCA
CGTTAGGTCTAATGCTCCATTGCATCTACAGCGTCCAACGTGACTTTGTATCCTTTTCGGTCGGGATCTTGAACAGCTCCGTCAACATGTTCAGTATCGC
CAATTTGAAGAAATTCCAGCATATTCCCCCAGAAGAAAGCGTCGACCAAAAAGGGGGACAACAACGCATTTGCGCCCCGCTCCAGTGGCCGACAACGGGT
ACAGTAGTTTTCGACAACGTGTTTTTCAAGTACGATGCAGTGCAAGATGATGCTGACACGTCAGTGTTTGCGTTAAAAGACGTGTCTTTCTCGATTTCTG
GTGGCGAGAAGATCGGCATCGTAGGGAGAACTGGGTCGGGCAAGAGTTCGCTTGCTATGGCAATGCTGCAGATGCACAGGCTGCCGCGTGGTCGCATACT
TATCGATGGAATTGATATTAGCCGTCTGCATCTGCGTGACATCCGCAGCCGGATCTGCATCATTCCACAGACTCCCTTGTTTTACCGAGGCTCAATTCGC
CGCTACTTGGATCCGTTCAAAGAGTTCGATGACGATGCATTATGGGAAGTGCTCGTGAAAACTGGTCTTTGTGAGGCGCCAGGACCAAATGAAGATAGCA
TGAAAGAAAACTACGACGAGATTTTTACCGGAGCGCTGGCCAGCCGAGTGGTGGTGACGAGTTTGGACATGAGACTTGCAGAGAACGGTGAGAATTGGAG
CATGGGCGAGCGGCAGATGCTGGTACTGGCACGATCGCTGCTGAAACCTGCGCGAGTTCTCATTCTGGACGAGGCGTTCTCATCGGTCGACCAAGACTCT
GACAAACGGCTACTCGCTGTAGTCGAGAAGGAGTTCGCTAGCTCGACGATATTCCTCATCACCCACCGTTTGGACCAGGTTCTGGGTTTTGATCGCATCA
TTGTTATGAAAGACGGCGCCGTTGCTGAGTGTGGAGCCGCAGAAGACCTGGTTACGGACCCAGATAGCGCCTTCTACGACTTCTTAGAGACAACTTTGCT
CACATATT