Description :
From Genome Similarity Track
Location :
Scaffold_476:8484- 9806
Transcript NameFunction/comments
Phypl_g8705conserved hypothetical protein
Phypl_g8706hypothetical protein

Sequence
1322 bases(100 bases per row)
GGTGTTTCGAGGCGAGTACCATGTGGACGGAGGGCTGCTCACTTTGGTGCCGGAAGTCCCCGGATACGTCAAGGTGTGTGCCTTCCACGGGCACATGCTG
CGTCGCGACGACTACGAGATCAGTCCGTCGATCGACCCCGAGTTCCCATATACAATTATGCAGTTGGCCCGCTTCGCGATGATCCCGCCGGAGATTGAAG
TGCTGGATGAGCTGTTCGAGTTGGGCCACAAGTCGGCGAGTATCTGGTCGCAGAAGCAGGTGAAGGCCGTATCGAAAGTGGGTGAAGGTAATGTCAACAA
GCAGAATGTGCTGTGAGAACCGAGCGCGATGGTAGCCTGTAGTAAATTTAAACGAACACTTTCTGTTTCGGCTCAGTTTCCCATTTGGACTCTCAGTCGT
CTACCGTACCAGCGTCAGATGAGCTACTAGATACCGTCGAGCGAGATGACactgaagacgaagaggacgaggaggaggaagacgacgaagaagaggacga
agacgacgaagaggacgaggagctctcgTTACCAGGGTCTTCGTCCGCTTCGGCGcggttcttcttgatctctGCTTGTACTCGGCTCTCCTTGGTAGCA
GCAACCGCTGGCTTTGGTTTGGCTTGATCTCTCTTAGTTGCTTTGGGAACCTTCGCAGTTGCAGATGCAGACTTGGTGGTTGAAGCGGCCGTGACCTTCT
TGGTACGGCTGCTAGACGCCGtagtcttcttcttcggagctgcagcagtcgcggCTTTACCGTTTGCCTTGCCATTAGTTTTAGCTGTCTGTGCAGACGC
AGACTTCGGTTTTGTCTTCTTGGTGCTACCTGTGGAGGCATCACTCGGAAGATTCGATGAAACAGGCGTGGCTGGCGTTGTCGTAGATGCAGCTGATGGA
GTCGGTTTCTTTCGACTTCGCTTCCGCGCCGAGTTGCTTGCGGttctcaagctgctcgcagaTACCAAAGGCTTCGACTCCAGGGTCTTCAGAGTGGCTT
CTGATATTTTGAGCTTCTTCGCAGGTGGTTCCAGCGCTTCCATTAATCTGTAAAGCACCAGATGATTAATCCAGGGTTACTGTCTGCATCCTTTACAAAT
GCACTCCTGCATTGTTGAAAGCCTGCTCACCTCTCCCGGCGTCTCCTCTGCCTGTCCTCCTTCGCCCTCAACACTGCAGCTTTTCGCACTTGCTCCAACT
TCTCCCGTTCTAGTACAGCGGTCCGCGTGTCCAGTAGTTTGAGCTGGCTCGGATTAACctgcaacaacaagaagagcaTCAACACCAACTGCTTCTTCCT
CACAGCCGAGATACTTGTCCGC