Description :
From Genome Similarity Track
Location :
Scaffold_337:8483- 9568
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_337-snap-gene-0.17Importin subunit alpha

Sequence
1085 bases(100 bases per row)
TCACCGACTTGtAGGATCCTCTCTAGTCCTTCCAGCGCCATCATCACCATGCTCGTCTCTTCTAGCAGGTTTCCTAaTATCTGGATACAGCCTTCGTTGA
CCAAGTACTCGATCTGACTGTCGGAGCCACACGACGTCGCATTGAGAACCACCCAGCAAGCCTCACTCTTGACCTCAGCGTCCGTCGTATCCGATGATGC
GAGGCCCATAAGCGATGGGATGCACCCCGAATCCAGCACATGCTGGATCTGGTCGACCGTGCCGGCAGCAATGTTCGATAAGGTCCAACAAGCTTCCTTC
TGGATTTCGCGGTTGGAGTGCGCGATCAATCTCCGCAATGATGGTACAGCGCCGCACTCGATGATGTGCTGCGTGTAGTCATGATCGTCCTCCGCACACA
CAATGTTGCCGATTGCTCGTAGAGCTGGCTTCGTCACGCGCCACGACGAATGACTCAACAGTTCTACCAGACGGAAGCAAACTTCCGAATCCACTACAGC
CTGGATATGAGAGCTAGGTCCATCACAGAGATGCGAAAACGCCCAGCAAACGTGACTCAAAATCTCCGTGTCGGTGCTGGAGAGCATCTGGCGGACGaTC
AAAGCATGAGagggATCCAAAAGGAGTCTACAGACCCATACAGCTGCGTACCTTTGCGAGATAAGGCAGGATAATCGTGATGTCAAACACAGGACGTGGC
TGACCATCGCACAGGTTACTCAGCGTCCACGTGAGAATACGCAGCAACGAGAGACGATCCCACGGGGTCTTCTTGAGCTGATTCACAAGCGGGATGAGGG
CACCAGCGTTCAGCACAAGGTCACGAGTCGCCGAGCCTTCACCCGCGAGGTTgCCGAGAACCCATACTGCTTGCTCAAGCACCTGCCGTGCAAGCTctAA
TCAGCTTTTCTATCGCAGCATAGCaTACACTAAACACAATgaTGTACCTCTTCATTCGACGAGTCCAGCAGCGACACCAGGGTCGGAATCACACCATTCT
GTagCAGCACCGACGTATTGTCGGTCGCACCAGCGGCAATGTTGGTGAGTGCCCACAGTGCCTCCACCTGGAGTGTCGGACGGTC