Description :
From Genome Similarity Track
Location :
Scaffold_476:8482- 16464
Transcript NameFunction/comments
g15110.t1hypothetical protein
g15111.t1OWZ16347.1 reverse transcriptase [Phytophthora megakarya

Sequence
7982 bases(100 bases per row)
TGTAATGGGCCCCTCCCATTTACATATGTAGGTAGATCTATATAGGTAGATCTACAAAGTAGGTACAAAGGCACGCGGCTAGCGTGTGCCTCGTTGTCAT
CCTGCGATTGGTTGAAAGTGGGGAGCCAAACCCATTTCGACCAATCAGGTGTCAACCTGCATTTGAGTGGTTCACATGAATCCGAGGGCCACCCGCCCCG
GTCCCAATAATAAACCAGAGTTGATTTTACCCTAGACTAAACACTTGGTCTCAGTATACCTGAGCTTATTGGACGCTTCCTCACCGCTACGTGTAAGCTA
GTGACGGGCACTCACCTGGCCCGTTACACCTGGTAGCACTTCGTAGTCCTTCCCATGACCAAGTTCGAGATGAGTGAAGACCAGCCCGCCGGACCTCCAG
TGATGACCCTGGAACACGCGGCCTTCCCCCATCTCACGTCTATCGAGTGGCAAGCGTTGCACCGCCTCGCGGCGGTGTCCGGAGAAACCGTCGTCACGTC
GCTGCTGAGCTCAGCGACCCCCGACCAACAGCGCCAAGCCATCCAAGAGTTCATGGACCGCGAGCTTGCCGAAGCAAAACGGCGAGTATCAACTCCCTCG
CATGCGTCCAGGAACAATGCCGTCAAGATGGAGATATCCTCCTATTCTGGCGAGGGTCCTGATCGACTACCTCTGAATCGCTGGTTCAGAGAGATCGACA
TCGCGATCGCCTCGAGGCTAATCGAGGCGCCGTCAGCCAAGGTGAACTTCTTGCTTTCCCGTTTGTCCGGAAAGGCCAAAGAATGGGCACTCGGCAAACT
TGTCGTCGACCAGTACGCGTTCCCGACTCTGGAGGCACTCCAGAGCGACCTGCGTCTCGCCTTCGAACCACCACAGGATGAGTCGCGCGTTCGAGCTACA
TTCTTCGCCCTAAAGCAAGGCAAGATGGCCATGCGCGACTACGTCCAGAGAACGCGACACCTTGCATCGTGTATCGTCACGAAGCCGATCGACATGGCTT
CCCAAGTCCATGTCTTTGTGTTTGGTATGTGCGAAGGTATGACGCGGTACTGTCTCACGCGCGCCGAGCCTGCCACGTTGGAAGAAGCCTTCGCTCTCGC
GCTACGCGAGGACTACCTGGTGACGTCGTCATACGCCAAGACGATGCCTGCGCAGACTTGGGTGTCGGTACCCGAGCCAATGGAGATCGATGCGATCGTG
GCTTCGCAGAATCGACGGTGGTCGTCCTCCGGGAGAGGCCGCGGTGGTCAGAATGACCTCTCGCTGAATTGTTTCCGCTGCGGAAAGCCTGGTCATCGCG
CGGCGGTGTGCCGCGAGCCAGCTCCGATCCTCGCCCACATGAAGCACGTCACGCCCGACGAGAGGATTCCGGCCGCACAGCCAAAAAACGGCCGGGACCA
GTAGGTGCGGGGCGACCTACTGGCTGGAACGGAGGTCCGGGTCCCCCGGCGGCAGCCCGACCTCCTAGCCCCCCTGTGCTCTATGCACACTTTAATGCCA
CCACTGCTAGTGGCGACTCGAGGCTGATTATTGGCAGCCTTTATGTCGCCGGTGCCCGACGACCACTCCGCGCGCTCCTGGATTCAGGAGCGACGAACAA
TTTCTTCCGCGCTTCATGCCTGTCGATCCTACCCGCGGGTGTTCCCGTGCGTGATGTGCCTGGTGATGTCGTTGTCAAGCTTGCGGATGGAAAGCCGTTG
CGTGTCGCGCGACGAGAAGTCTCGTTGCCGTATACGTTCGACGGCTTCCGCAGCAATGACAACTTCATTGTGTTTGAGATGAACTACGCGTTTGACTGTA
TCCTGGGTATACCATGGCTGTCCCGGTATCAGCCCCAGATCGACTGGTTAGCCCGGTCAGTCAAACGGCGACGCGACTTCGATGTGAGCGAAGTCTTCAC
GCACCTCTTGGTGGCACCAAGAGACTGGCCCCATGTCACAGTCGTGGACGGGACGTCCACGACGCACGTTGTGCGCAGAGCGAGCGATGGCCCTCTCTGC
ACGACTTGCGCAGTACTGCTGACTGATGACGACAGCGTCGAACACCCGTCCGGTTACGGGCGCGTGAGGCGAGCGGTTGAGCATCCGCCGCTCCCGCGGA
CGAGGAACAAGGCGGCGGAGCGCATGGCGCTCCCAGCGACAAGCCCGACGGTCGAGCAGGGGCTCCCGCGTGTTTACGAGACGGTCGAGCAGGGGCTCCC
GTATGATGATGAAGCGGTCGAGCAGGGGCTCCCGCATGCCAACGAGGCGGTCGAGCAGGGGCTCCCGCATGCCACCAAGACGGTCGAGCAGGGGCTCCCG
CATGCCATCAAGACGGTCGAGCAGGGGCTCCCGTATGATTTCGAGACGGTCGAGCAGGGGCTCCCGTATGACTTTGAGGCGGTCGAGCAGGGGCTCCCGT
ATGACTTTGAGGCGGTCGAGCAGGGGCTCCCGTATGACTTTGAGGCGGTCGAGCAGGGGCTCCCGCATGACTTCGAGGCGGTCGAGCAGGGGCTCCCGTA
TGACGATACCGCGGTCGAGCAGGAGCTGCTCCCGCGTATGAGCGGCGCGGTCGAGCATGGCCTCTCGCGCCTAGAGGAGGGTGAAGCATCGTCCGGCGAC
AGCGAAACATCGGTCTTGAGCAGGGGCTCGAGACGCACGAAGACATCCCGACGGTCGCGGAGACGTTTGAAGCCGCGCCGCAGTCCAGTGGAACTCACGA
CGCCACCAATCGAGTCGGTCTGTGCAGTCGAATATGTGGGTGGTGTTCCCAACCACGCTCGAATGATCAAGGTCGCGAGTCCACCTCGCGACGCCAAGTC
CATCACGGACCTGCCAGGTCTCTCCTGGAAGAGCTTCCTCCGGGATCTCAAGGATGGTGACATCGAGCAAGTGTGCCTGATCACCGATGCCAACCCAGTG
TCTGACGAGACGAACGCAATTGCCCATGATGACACGTCGTCGCGCCCGAAAAGCGCTGAACCAAAGTCAGCGCGCGAGGAGCGCTTCGCTGCGCAGTCGT
GGGAATCGCTGAAGGCGTCCGGCAATCCGGTCTACGAGACAGCTCGCGAGTTCGCCGACGTCTTCCCAGACAAGATCCCTGCGGAGCTGCCAGCGGATCG
CGGAGTGCGCCACGAGATTGACCTCGTGCCTGGATCGAAGTACTGCGTGACGCGGCAGTGGCCACTGCCGCGCGATCAAGTCAAGGCCATCGACGACTTC
TTCGAAGGCCGCCGCCAAGCCGGTCACGTCCGTGAGAGCATCTCGCCTCACTCGAGCCCGACCTTCTGTGTGAAGAAGGCTACTGGCGGGTGGCGCATCG
TACACGCCTTTAACAAGTTGAACGATGCCACCATCCCGGCGCAGACACCGATCCCGCGGAAGGACATGGTACTGGACTCCATGTCGGGCAGCGTCATTTA
CAGTGCCATCGACTTGACCGATGGCTTCTATCAGATCCTCATGAGAGAGAGCGATGTACCTCTCACGGCAGTCAGTACGCCCAGCGGTATGCTCTGGGAG
TGGCTCGTGATGCCCCAAGGTCTGAAGAACGCCCCAGCCACATTTAATCGCATGGTGTCCCATGTGCTACGCCCGCTTCGTGACTTCGCTCCGAGTTACT
TCGATGACATTTTTGTGCACAGTCACGCTGAAGAGGGTCTCAGCGCGATCGACGTGCATCTGCGGCACTTGAGGCAGGTCTTTCAAGTGATGAGAGAGAA
CAAGCTCTACGCGAATCTCAAGAAGTGTGTCTTCTGCGCGCCGGAAATTCCGGTGCTTGGGTGCTACGTAAGCAAAAACGGAGTCCGTGCTGACCCGGAA
AAAGTGTCGTCTATTTGCTCGTGGCCACCACCATCAAACCCCACTGAGCTGCGTCAGTGGTTGGGCCTCGCTAACTACTTGCACAAGTATACGAAGGGAT
ATGCCGGCTTGATACAGCCACTGTCGTCGCTGTTGAAGAAAGACGCCACGTGGTCGTGGCGCCCCGAGCATCAAGTAGCCTTCGACTCGGTGAAGAAGAG
CTTGGCCTCGGCGCCAATACTGATGCTCCCAGATGACGCGAAACCGTTCCACGTCGTCTGCGACGCTAGCGACTTTGCTATCGGGTGCGCGCTCATGCAG
TTTGACAACGAAGGCTGCGAACGAGTCGTGAGTTATCAATCACGACAGATGAAGCCGGCCGAACGCAACTATCCCGTCCACGATAAGGAACTTCTTGCGA
TGCGATACGCTCTGATCAAATTCAGAGTGTATCTGCTCGGAGAACAGACGTTCGCGGTGTACACGGATCACGCATCGCTGCGCACAGCGATGAAATCCCC
ACATCTGTCTCAACGCATGGCACGATGGTTGTCGTTCTTCGCTGAGTACAACTTCGTCGTGCACTACAAGCCCGGCAAGAACAATATCCTCGCCGATGCT
CTGTCTCGGCGTCCAGACTATGATCCACGAGCAACGCGGGGTCGTCAAGTGATTGACGAAGACGAGGATGACGAAGATCACTGTGCGATGTGCTTGACAT
CAGGTGTCAACCTGATGAACGTGACTCCAGAAATGCCGCTACGCGAAGAAATCGCCGTTGCGTACAACGACGACGCGGTATATGCCGCCATCCTCGCACA
TTTTTTTTCCCCCAGTGATAAAACACTCCGCGCGCTGCCGAATAACACGCGCAATCAGATTAACCGATATCAACTCGACGGCGATCTGCTGACGTATAGC
ATCGATCGATTCGATGCTCCCCGCATCGCCATCCCGAACGACGATGATCTGCGCGCTCGGATCATCCACGAGTTCCACGACAGCCCTGTCGGTGGTCACT
TGGGCCGCGAAAAGACGTTCGCGGCAGTATCCCGCGACTTCTACTGGCCCCACATGTACAAATGGGTGCGCAAGTGGGTCCGTACTTGTGAGATTTGCCA
GCGCGTGAAGCCGTCAAAGTCGTCGCAGGCTCCCCTGCGACCCCTGTCGATTGCAACTGAGGCGTGGCGCTCAGTGTCGATGGACTTCATCTTCGGGCTT
CCACCCGATGCCGACGGTCGGACTGGCGTCTTGGTGTAGGTGGATAGGTTCAGCAAAATGGTGCATCTCATTCCGGTGTCCGACACGATCACCGCGGCTG
AGTCCGCGATGCATTTCGTTGACGCGGTCTTTCGAAACCACGGCTTACCTGAATCGATCGTCTCTGACCGCGATCCGCGGTTCACGTCGGCATTCTGGTC
GAGTCGTTTCCAACTTCTGGGAACGAAGCTGCTCATGTCAACGGCGGTGCATCCGGAGATGGATGGTCAAACGGAGCGGGTCAACCGAGTCCTCGAAGAT
GTCCTTCGAAGTTACGCGACTTCGTTCACTAATTGGAGCTCCTTTTTGCCGCTTGCCGAGTTTGCGCTAAACAACGCGGAACACGCATCGACGGGTCTGA
CCCCCTTTTTTGTAAATAACGCGCGGCACCCGCGCGTTCCCGCTCTGCTCGCCGTGGGCCACCCCACGATGCCTCGTGGCTCCACTCTGGGTGGGGAAGG
AAATGATGGTGCTGGTAGTACGAACACAGACACACCGATACCGATACCGGTATTACCAGTGGTGAGCACGGATGGCACACCACCACCACCAGCTCCCTTG
TCGAGTGCAGCCCACGAGTCCGTGACGCTGAATGCAGTCACCCGCGCGAAGTCGAGACGGACCCTTGCGACGCCGAACAACGCGGTGTCTTCACTGACAG
ATTGGACTGCGCGCACGTTAATCAACCCTGGCCCGGCTACCGATCCCGTCGCAGCTAACTACGCGCCGAAGCCTCCGGCGCGTCCAGTCGATGATGCGGC
CGTCTCTGAGTTCGTGCTGCAGCGACAATCGGTCACCCGATTTGTACGAGATGCACTGCAAGAAGCAGTGGATAAGCAGAAGGAGAACGCCGACAAGCGT
GGGCGCAAGAACGTGGCTACATTTACGACAGGAGATCGTGTGCTCCTGTCGACAGACGGCATACGCTCTTCGGCCGTAACGAATCTTGGCGCGAGCAAAC
TCGCGCCGCGCTTTATTGGCCCCTTCAGGGTTACGAAGGTAATCGGTGATGCCTACACACTGGACATACCATCTTCCCTACGACTACACCCGACGTTCTA
CGTCGGGCGACTCAAGAAATACCACGCAGCTACAATCCCGTCGGCCCCGGAGCATCCGCCGGCGCAGCATGAACAGGACGTCCCTCCCGACGTGCGCGCC
TTGCCATCGAGCCATCCGAGCCATCCGTCCGCTCGCGCGGACGTGCTGCCGTCTGCGGCGCCCCGAACACGCGCCTTTCCAGCTCCCGCGTCCGTTGCAG
CAGTTCCGCACTCGTTTGGCGAGCAGCCGCTGCTGCACCCTCCGCCCGACGAGCCCGCTCCTCCGCCGCCTCAGCATCAAGCTGAGCGTCCCGCGCCCAA
TTCACTGCCTCGTCCACGTCATCCTGGGCGCCAGGACGCGAGCTCTATCGTCGCGAAGGTCCCCCGCCGATTGTAGACTCGGCTGGTGATATCCGCTGGA
TCGTGGACCGTATTGTGGAGCACGAGGATCCACCTCGTACGTATGCCCATACCCGTACGAGTACGCGCTCCAAGCACGCGGTTCCGACCGCGCGACGTTA
CCGAGTACGATGGCTCGGGTTCCCTCCGGACGAAGATACGTGGGAGCCTCGCGCCGCACTCCTCCGGGACGTCCCGGATGTTGTCCGCGAATACGAGAAT
ACGATCGTGAACGAGAACGACGCCGCAGCCGGTCCTGCGGCGAACGAGAACGCGAACGCTGGCGTGCACGTCCCCGTGGCGGCGGAGGACTCCGCTGAGT
ATCCCCGCGGCGTCCGACGCCGCGATTAGTAGACTGGGCCACCTCGGAGAGCGTGCGGCGATATTTGGCGATCCACGACTGTTCACTTTCGCTGAGCGGA
TGCTCAGTGACGCGACGCAGCCATTCTTCCTCGGACAAACGCTCGGAACTCTCGCACGACGTGCAGCCTTCGCGCACGTGGACGTAACAATCATGGTCGG
ACTCCCAGGCGTTCTTGCAGACGCGTGCTCTCAGCTCGCTGAGAGAGTGTTCACCGACGACCTCCTCGCGACTGGTGAGCCAGGCGACGAAGTTGCTCCC
CTCCTGATGCATCCGGTTCCACCGGACGATCATTGCACACCACGACCGCTGCAGCGCATCGTGCGAGACACCCGTCAGCGACTTCCCCCGCAGCGCACGA
AATCGGCGGAAGTAGCCCGTCATCTCCTCCAGGGATCCTGGAGACTTCGCTCCCGACAAATCGTACTACGCCCAAGGCTTGAGCTCCCGGTCCATAGCGC
GTGTCCGCTGGGTGAGTTCCAGCGGCGGGTCCTCCACGATCGCCGCCATAGGTGTTGCCCGCGCTATCTCCGCTGCCGAGTTGCTCGCGCGTGTTCCATC
CGCAGGAGTCCCTGCGCTCGTGTCCGTCTGTCGCTCCATCTTGTCTCCGATCGCGCAATTCTGATTGTGCCTCTGCGGTTCGCAGAGGTTGCTGCTCGTC
GCCGTTGAGACCATCCCGTTGACGCCGCGTTCTCGCCGTTTCCCAGTTTTCTTTTCTTTCAGTTTTCTTTGCTCGCACTCACGGAAGCGTGAGTGCAATC
TTAAGAGGGGGGTGATGTAATGGGCCCCTCCCATTTACATATGTAGGTAGATCTATATAGGTAGATCTACAAAGTAGAGACAAAGGCACGCGGCTAGCGT
GTGCCTCGTTGTCATCCTGCGATTGGTTGAAAGTGGGGAGCCAGACCCATTTCGACCAATCAGGTGTCAACCTGCATTTGAGTGGTTCACATGGATCCGA
GGGCCACCCGCCCCGGTCCCAATAATAAACCAGAGTTGATTTTACCCTAGACTAAACACTTGGTCTCAGTATACCTGAGCGTATTGGACGCTTCCTCACC
GCTACGTGTAAGCTAGTGACGGGCACTCACCTGGCCCGTTACAAGCGCCCTCGCAGAAACCTGCAAAGTCGTCCTCGCACAA