Description :
From Genome Similarity Track
Location :
contig_49:84815- 87777
Transcript NameFunction/comments
g8258.t1hypothetical protein

Sequence
2962 bases(100 bases per row)
TTGATGGTTTCGGTGCAGTTTCCCGCGCGTTGGGGACGCTTTCGTCCATGCCCGAGACTATTAAGAGTCCACCGACTCGGATCACTACTGCCCCGCACGC
TGTTGCCACGTTTGAACGCGATCCGGTGTACATGCAGGGAAGATATCTGAAGTTCCAGCGTGGACTCAGCCAGACCCCGTGGGTTCTTGATGGCGAGCGA
ATGGGCGAATCCTCCGTGGAAGAGTGCATCGGTGACATCGCCCTGCCATTCTTCAAGGGTGCAGGCTACAAGTTTCACACAGCAGGTCGTGAAGATGTCG
ACGTGCGCATGCTAGGAAACGGAAGGCCTTTCATCTTGGAGATTTTGGGTAAGCTGCAACTTTACGTTTATGTAGCGGTATTAGACTTGGCCTATCTCAA
CCGTATTTGTTTTGCCTGCAGACGCCAAGAAAGCGTACCTGAATCAATCAGAGTACGATGGAATTCAGAAGGCTGTGAATGCCGCAAACAATGGTGCTGT
CGAGATTGTCCAGGTTAAGAGCTCGACGAAGGATTATTTCGCTGGGCTGCAGGCAGGAGCAGACTCAAAGAAGAAAACCTACTGGTGAGTGTTTTACCTT
GGGACAAACTACTACCTCAGGTTAGACTGACAAACACGCATTTGCTTCCATTATCAGCTGCGTTGTGTGGTCGGAAGGTGAATTGACCCCCGAGTCCGTT
GCGAAGATTGATGCAATTCAAGACCTCACCATTCAGCAGCAAACTCCTATTCGCGTGCTGCATCGCCGAACCCTGATGACGAGGCCGAAGATTATCCATG
CTGCCAAGTGTGAGGTGCTGAACAAGCATTACATGATGTTGCGCCTCACCACATCCGCAGGAACCTACGTTAAAGAGTTCGTGCACGGTGACCGTGGTCG
GACCAACCCCAACGTCGCGTCAATTTTGGTATGTTGTACAGCTGTGCAAGTGCTATTACGCGTAAAGGTTCGCTCACGTTGTCTCCCCTCCTTGCTTTTC
TGCCATAGGACTGTGACGCGGATATAATCCAGCTCGACGTCGAAAGCCTTATTGATGCCCAGTAAACCAACTCGGCGTGGTCTGCTCACCTGGACTCCAG
ATTCTGGAGATCCCAGCGATGATCCAATACATAGGAGATATTTTTGTAGAGCCATCATTGAGTCTGAATCGTTATGCGCATGGTTACTCGTGGATGGGCT
CAGGAAACGCTAACGAGTCGTATTGGGACTCATCCCATAGCTCACCAATCTGGTCTAGCAGCTCTTGGGCTCCCTGTGGAAGGGCTGCTGCTACACTTGG
ATCATCTTGACCTGCCGTTTTTGCTGTAACTGACGCGCGAAGCTCCTTGGCAGCCACCGCTGATGAGGACGTCTGCAGCAAGTTGAGGACTCCTTTCGTG
TTCGTATTCATGCTGCTCTGAGCATCACTCTTCTGCACAACCGTAGCAGCTACTTGTTCTTTGAACTCTTGCAGATTCAGAATATGTTCCTCAAGTGACT
TCTCCATGATTAGTCGGAATACCCGCACGGTTCGCTTTTGTCCAATGCGATGCGCACGATCCATCGCCTGCAGATCAACAAAGGGGTTCCACGAGTGCTC
GATGAAGATCACCGTGTCCGCGCCAGTAAGGGTGAGTCCTAAACCGCCCACTGACGTAGTCAGCAGCAAGACGTCAATTGACGGATCGGCATTGAAGTGC
TGTACAATGTCTGCACGCTTGGCGTGAGGTGTTTGTCCATCGAGGCGTCGATAAGTTACACCAGGTAATGCGTCCCGCATCATTTCCTCGGTGAGATCGA
GCGTCTTCTGCAGGTGGGCAAACACCAGGCATCGATGAGGAGAAAAATTGCTATCGTCATCACCTTCAGTTGCAGGTCCTTGGCGACCTTCCTGAGTCCA
TGCTGCAATATCGCAGCACTCAACCAATAGATCGCGCAATCCAGTCATCTTTCCTGAGCTTTTCCAGTCAAGCAGGGCCCCCGTTTCCTTCGTATTAAGC
CCCAAAGAGATTGCGTTGTCAGCAACGAGCGCTGGATGTACACAAATCTTGCGCAGTAATTGAAGATTTGTTAGCACGTTCGTCAATGGTTTCGGCTCGG
CCACCTTCGTAGACCGAGAAGATGCCACAGAGCTTGTGGGATCGCTCTCAGATGACGACGCCAGCGAGTACAAACGTTTCTGCAGCGAAGTTAACGGCAG
TAGCACGTTCGAGATGATTTTCGGTGGAAGCTCTTCCAGCACCTGGTCTTTCGTTCGTCGCAGTATAAATGGCAGAACCTTTTGGTGCAGTTTTGTGATG
GCAATCGCTGCGAGCTCCTTTTGCTTTGACGTTGCATTGCGCTCTTTTGACTTTGTGATTGGAAGGACAAACTCGCGACGGAATAAAGTAAAGTCGCCTA
AGTATCCAGGCATTAGGAACTCGAACAGAGCCCACAGGTCTGTGACGTTATTCTGCAGCGGCGTTCCACTCAAGGCCACACGATGTGATGCGTGAAGGTT
CGATACAGCACGGAATAACGCTGTCGATGGATTCCGAATCAAATGTGCTTCGTCCAACACCACAAAAGAGTAGTCAATATCTCCCAAGCGGTTGATGTCT
GTCCGCAGGATCGAGTATGTAGTCACGATCAAAGTCGTGCCGTGATCAGATATCACGATATTTTTGCCGTGACCCAACACTTTTCGGTCACTTGCTGGGA
CTGAGTAGTCGATGACAGATGCGAAGTATCCTGGAATGTATTTCTTGGCTTCTTGGATCCAGTGATGCACGATAATCGGTGGGCATACAACGAGACAAGG
CCTCGCTGGACGTTTGCTTTGGGCTGTAGATGTCATTGCTAGTGTTGCAGCCATGGCAGAAAGCGTTTGGAGTGTCTTTCCGAGGCCCATATCATCGGCG
AGGATCCCATGAAGATTGTTCCTGGCCATGAAGCATAGCCAGTCTACGCCATGCTGCTGGTA