Description :
From Genome Similarity Track
Location :
Scaffold_320:848- 2300
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_320-fgenesh-gene-0.0Methylcrotonoyl-CoA carboxylase subunit alpha

Sequence
1452 bases(100 bases per row)
CTTCCGCAAGATCCTCATCGCCAACCGCGGCGAGATCGCGCTTCGAGTCATCCGCTCCGCACAGAAGCTCAACATCGAGACGGTCGCCGTCTATAGTGAC
GCGGACGCCAACTCACAGCACGTCAAACAGGCCACAGAGGCGTACCGTCTCGGCCCAGCCCCAGCGAACGAGAGCTACTTGAACTATGAAAAGATCCTCG
AGATCTGCAAGCTCTCCGGTGCCGAAGCTGTCCACCCGGGCTACGGCTTCCTCTCAGAGAACGCCTTCTTCGCGCGCGCATGCGCAGACGCCAACATCGA
ATTCATCGGACCGCCAGTGAAAGCCATCGAGGCGATGGGCTCGAAGAGCGCGTCAAAGGATATCATGATCGCCGCGGGCGTCCCGGTCACGCCCGGCTAC
CACGGCGCGGACCAGAGCTTCGAGACTCTCCAGGCAGAGGCGAGAAAGATCGGGTACCCGGTGCTGATCAAGGCCGTGTTGGGCGGAGGTGGTAAGGGCA
TGCGCATCGTCGACGACGAGAAGGACCTCGGAGAGAACCTCGAAGCCTGCCAGCGCGAAGGCAAGGCGTCTTTCGGCGACGCGCGCGTCCTCATCGAAAA
GTACCTGCGCAAGCCTCGTCACGTGGAGCTGCAGGTGTTTGGCGACAAATTTGGCAACGTCGTGCACCTCTTTGAGCGCGACTGCAGCGTACAGCGTCGT
CACCAAAAAGTGCTCGAGGAAGCGCCAGCGGTGAGTCGTTGCTTACAACTATGAAGCAGGCTGTGCGTTGATCTCATAGCTCTAATTGTCCATGATGTAT
TGTTTTGCTCGCTCTAGCCGCACATGTCGGAAGCTTTACGAAAGAAGATGGGAGACGCTGCTGTCGCTGCTGCCAAGGCGGTCGGGTATGTCGGTGCTGG
TACCGTCGAATTCCTGCTAGATGAGGACGAGTCATTCTACTTTATGGAGATGAACACGCGCCTGCAGGTCGAGCACCCGGTAACAGAGCTCATCACGAAG
CAGGACCTGGTCGAGCTGCAGCTGAAGGTCGCGGCGGGCCAGACGCTTCCGATCAAGCAGGAAGACCTGAAAATCCACGGCCATGCGATTGAGGCACGCA
TCTACGCGGAGAACCCGTACAAGTGAGTGAATGTTTGTATCTTTCTGACTATACGTTGTATTTGAGCATAACTTCTAACGATCAATGTACGCAAATGAAC
AGCAATTTCCTCCCAGGAAGCGGCAAGCTACAGCACTTGCGACTACCGCCAGTCTCCGATACGGTGCGCGTTGACACAGGCATCATCGAAGGTGACGAGG
TATCGATTTTCTACGACCCGATGATCGCGAAACTTATTGTGCATGGCAAGAACCGCCAAGAAGCGCTCGACAGCCTGATCAAGGCGCTGCACCAGTACCA
GATCGTGGGTCTGCCGACCAACATCGAATTCGTCGCGCGCACTGCCGACCAC