Description :
From Genome Similarity Track
Location :
Scaffold_397:8479- 13801
Transcript NameFunction/comments
Phyta_totarag7913hypothetical protein
Phyta_totarag7914hypothetical protein

Sequence
5322 bases(100 bases per row)
CGCTTGCTATGGCTGTCAATTTTTGTGCGAGCGATTGTAGTACGCTCTTCCTTCGCGCTGTCTGCCAGCAACCGCGAAGTCGTCGTGCTTACATGCAACG
TATTAATAGCTTTGTTGATCCAATTCCTACGCAAGGCATCTCGTAGAGTGTGTACTTCGGTGTGCGGTCCCAGCTGTCCGGTGCACGAAAACTTCAAGGT
CTCGTCGCTGTTCGTCCTTTGCCTGAGCCAGAATGATCCCATAATCATCGAAGTGTGTCCATCCTGTTACATGAGTCATACTGTACATTGGTCTTAATGA
AGGCAAGCGTATCGTCGCCAGGTCAAGCTGCACGTGCAGGAGCTTCGCTGCAtatataccggtacatgtataccaTAGTGTGGGACAGATACTTTGTGCA
GGtaaagctacatgtattaatacatatactgcttgcagctcgtgtcGTTGTCATCTTCGAGAAGATAGCTACAGCACCGTCAATTCCCAATTGAGATGGC
ATCGGCGTCCTGCCTGCGTTGGAAAGGCATATAGCAAAGCACGGGATTGCAGGAGCCGGAAAGAACAACAACGCAGGTCAGACTGAAAGGCCGCTAATTC
GTCTCAGCAACTGTAAGACGCGTGCAATACCACCAAGTAAAGGTGCAGACGATCGACCATTTGCATTATCCGAAGTAAAAGCTTTCAGGATTGTTAGTTC
AacgacgccttcttcgcaGTTAAAAGGCAGAAGACCAAAAAATTCAATTGAAAGTTACTTGCAAACGAATATATAACCGCAACTCATGAATCGCGAGTGA
GAACTGCCACGCTGCGTGGCAAAGTGTCATGTGGTGGATCTCCTTTCCCAATGAGAAGAACGCTTAGTGGCGAAGCGAGCGGCGACGGGACTGCGTGGCC
GACTGTTGCGTGGTCGAGTCTGCATACGAGTCCGCCGACGAGGTGCCCGAGGACGTGGCCGACGCTGTCTTGGTCGAGACACCGGTTTTGCCAGACTTGG
TagtgctggtggtcgtcgtAGTGtccgaagaagtcgacgcGGCAGTGGTGACTGGGGCAGTCGTAGCAGAAGGCGCGTTAGTCACCTCAATCCAAGTGCC
AGAGCTGGTAGAGTCCGTCGAGGGCGTCTCGGTCGCTGCAGAGACCACAGACGACAGTGAGCCGGGCGTCACGCCGTGCTTGTAGTCCGCCGTTGACCAA
GCCGCGGTCGCGCCCGTAGAACTCTGGTCGCTCGAGCACGGCGTCTCCGCCGATTCACCGCCCTGCGTCGTGATGTCCACAGCGATGGAGCCCGACACGT
TCGTCTCGGTCGAttggccttgctgctgctgctgctgttgttgctgctcaccggtggagctgctggtggtggtctCGGTCGACTgaccctgctgctgctg
ctcgtccgtcgCGCTGGAGGCGGTCTCAGTGGATTGACCCCACGTACCCGTAGAACTCTGGTCGCTCGAGCACGGCGTCTCCGCCGATTCACCGCCCTGC
GTCGTGATGTCCACAGCGATGGAGCCCGACACGTTCGTCTCGGTCGAttggccttgctgctgctgctgctgttgttgctgctcaccggtggagctgctgg
tggtggtctCGGTCGACTgaccctgctgctgctgctcgtccgtcgCGCTGGAGGCGGTCTCAGTGGATTGACCCCACGTACCCGTAGAACTCTGGTCGCT
CGAGCACGGCGTCTCCGCCGATTCACCGCCCTGCGTCGTGATGTCCACAGCGATGGAGCCCGACACGTTCGTCTCGGTCGAttggccttgctgctgctgc
tgctgttgttgctgctcaccggtggagctgctggtggtggtctCGGTCGACTgaccctgctgctgctgctcgtccgtcgCGCTGGAGGCGGTCTCAGTGG
ATTGACCCCACGTACCCGTAGAACTCTGGTCGCTCGAGCACGGCGTCTCCGCCGATTCACCGCCTTGGGTAGTGGTTGTCTGGCCCCATGAATTGAATTG
TTCTCCGGCAGCGGTCACAGTGCCAGTcttgtcgctgttgttggtggtgtcggATTCGCCGCTGGCGCATGGAGTTTCTGCTGAATCTCCATTCTGGTTG
GTGATGGAGCTCCAGTTCGACGTGCCGGTGCTTGTCTGACCGCTTTGAGTAGTGGAATCCGTAGTTGAAGTGGACGGAGCCGTGGTCGGTGCAGTCGTTG
ACGTCGTGCTCTGCTGAGTTGCCGAGTCACTCGTAGTGGAGTCGGTCGACAGGGACGAAGTCGTCGacttgctggtggtcgtggtgtACGAGTCCTCGTT
CGAGAGCGAGGTGGCCGTAGTCGTGGATGAaacaccgccaccgccgccaagcCTCCGCACCACTGGGCTGTTCGCCGCAACGGAGGCATCTGCGATTGAA
CTCACCGCCAGTGACGCGAGCGCCAAGAACGCGACGATCTTGCCGATCTTCATTCTGCGACGAAGGGGAGCGGGGTAATTGGGGGGTAGTACACtcaggt
gctggaggacggAACGATGCTTGTCGGCGAAGCAAAGTAAATTGGGGAATGTTCATGGTGTGAGGGGGAGGCTCGAGTGCCCTCACGAAGGGCCAGGCGC
ATGACACCCTAGCGATGTGTCGGGCACAGACACCTTGGTTCGTCGTCGAGTCACAAGATGCGCCATGCATTGGTAGCTCGATCGCCAGCAGGAACCGATT
GCAGCGGTGAGGGATATCCTATCTTGCCCACTGACAGGCATCGCCATATGCCGGCGCGACTACTGTACTCTCCGGTGGatgcagtacatgtaatgacGTT
GGTCACGGTCGTGCACCCGAACGCTGAAGACGAGGCTGTCGAGGCCTGAGATCACCGTCGAGACGCTCGTACCGCCATCGTAACCCGACAAGTGCCACAA
GTGGCCACAAGCAGGTACACGTAATGCGCGTGTGGCTGAGATTTTGGTAGGATCATGCGACTGATTCATAGATCACCTACCGTCTCAATACAGTGTAATA
GGTCACGGTGAGGCTAGCACGCCGTGCCGCATAGAGGGCCTCCTATGCTGCACGCGCGACACCGACCGCGGCTTCAACATTTGCCGCGGCGACGGATGGC
GCACTCACTCCAATGATCTCTGCTGCAGTAACGTCGATTATCATTTGGTCATGAAAGTCATCACGCCTGAGTCAGACCTTGACACCCACTGCCGCCCGCC
AGCTGGAGGCTCGATTGTCGAAGAGCTTTTACGCCAGGCTTGACcgtccgtcgtctcctcgaGGCGCGGACCACCTTTCCCTGGTCCGTATTGCGCGGAT
accacgaagctgctcactTGTTGCCTTTTATGAGTGGATTTTCCTCTCGACAGTCGGCTCGCTGCCTTTACATGTGTGCATGTAATTGCAGAACTCAATG
CGTGATGGAGGTGGgatcagctccagctcaccaCGACGACATTGAACCTTTCCGGTCAGAGCTCCCTGCAATGGCAACCGCTACGCTTACTGAGTGTTTT
GAGCCGCCTCCGCTCCGTTGCGACAGCAGAGCAGATCGCCGTGGCAACGTGGCCTCAGGACAACATGACCGAAATCGAGCCCAGCAGCGTGGACAACGAG
CACCGCGGCGTCTTCCTTACCTCAAGAAGCCATCGTGCCCAATGGCTAAATCCAACCAACATGAATTGTTTTCACGAAATTTCGCCTTGAGAGTTTCAAG
TAAGCTGTGATCATTCCTCAATGACAGTGCCATGAGCTCAATTGAACTATTATAAACCAAACGTCACCATCTTACTGCATCAAAAGCAACAGCGCAGTTT
CGTACACCGAAATGGTCCTTCTCGGTCGCTACGTTGTAATGCTACGCTGGTCGACAACGTGCTGATGGACCATCAGTGGTGCCAAGCAGATCCGAcgtgg
tacatgtacttccgGCGGAAGTTCCGCACAGTTTGTTAGGCCCGAAAGGCATGCCTCTACGAGTCTGGAGCGAGTAGTGCAGAGCTCACGCAAAACGTGG
CGCCGCATGGATCCCGCCAGAACGCTCGAGGAACTGAACGTAAATGTCCAAGCGAGCGGTGCTTGTCGTGCAGGCCTCGTTGAAATTTTAGTCGGTCGAT
ACTCCTTTACTTGTAAAGCACGCACCAAGGTAGCTCACGCAAGAGTAAGTCGGTCACGCGGATATTTCGGGCACCTCCATATGAAAGATGCCATGCGCCA
GTCAAATTCAAAGCTGCCCCGACTCAAGCAAGGCACCTGAGGGCTTGCCACCAGGATGTGAGCACGGTGTATGCCATCTGCGAGGCCACCAACACACATC
TGCCAGCCACACACTGTGTGACACAGCTGCCATGAGGTAAGTGGCATTCCGCAGCAGTTAATTAGCGTAAATGCCTCTGGAGACCATTGCGTTAGCTCGA
CCTAGTTCGGTTGTTCACGGCCGTCCGCATGCTGCACTGCGATACTGTAGGCATGCGCGCAATATCCACTCCGTCATGCTGACTCTTGCTTGCTAGTGGA
GACTGAAATGCACTACAGCAGTTAGTGACGCCCGGGTGAGACTGCAATTGAACCCGACAGATGGCGGTCTCATAGGATATCACTGCAAAGGATGTTCACA
ATGGACTCGATCCGCCTCTTGGTGTATCTTGGTAAATCAACACGCTGTCAAGTCGCCGTTGGATGAATAAGCCTGGTCAAGTAAGGGCTGCACGATGATG
GAGACGTAGGAAAATTGCTTCTGCTCCCATGAGTCTGGAAACCGTTCCAATGTGTCAACTCCACTCATTCCTAAATTTGTTTTGCTCCCCACAAGCAAAC
ACCCACCCCGAGCACCTGAGATTGTTATCTGTCACCAGCTCGATCCAGCAATACCCGAGACTTACAGGATGAACCTCAGCAAGATCTTTGAGCACCTCGC
TTTGTTGTCGCTGGCCTTAGGGTCTCTCGCGGACGCCTCCGTCATGACTCCTAACACGCACTCAGTAGTTCGTCAGAACAATGCTTTGCGTAACCTGAAG
GTGGCAGGCACGGGCACTGGTGTCACCACTAGTACCTCTTCGGGTGACTCGTACACCAGTACAACCGACTCGACCATGAGCACCACGAGTGACTCGGCCA
CCCAGCAGAGTTCTCCGTCGACCGACACGacttcgtccaccacctcgacggATACGACCACGgcttcgtcgccgtccacTTCGACCACCTCGACGGGCTC
GACTCCGTCAACGGATACCACTACGCAGGGCACTGACACGACTACTCAAGGCACCGACACGACTACGCAGGGCATTGACACTACCAGCACGGGTACCACA
AGCGGCACGGACACCACATGGG