Description :
From Genome Similarity Track
Location :
Scaffold_946:8479- 10875
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_946-fgenesh-gene-0.1Phospholipase D; Pi-TM-PLD

Sequence
2396 bases(100 bases per row)
GTCGCCGCACGCCTCGCGCTCAATGAGCACAGCGGCCTCTTGCTCTACGCCGGCGTGCTCAACTCTTTACTCGGCAGCTTCCTCTCGGCGAGCGGCTACT
GCTGCCAGAAGTTTGCGCATACGCGCGTGCAGCGCGACGCCGCACTGGGCACGGCCTCGCAGCAGCCCCTCTTTGCGTTCGGCCTCTTTTTGCTCGCCGT
CGGCACGGTCTCAGCTGTGCTCAACCTGGGTATTCTCGGCCAGGCCGTGCAGGCGCCGTTCGCGGCGCTCACACTCATTTACAGCGCGCTGCTCGGCCAC
TTTGTCTTGCGCGAGACGTTTGCGCTCTTCGACTTGTTTTCCAGCGTGCTGATTGTCGCTGGCGTCGCCGTCGACGTCTTTGCTGCGCAACTTGCCCAAG
TGCCACCTCAGTCGTTCACGCTGCACTCGCTCGACGCCCTGCTCTTCCGCAACTCAGTGTTCCCCATTGGATACGTCATGCTCGCGCTGCTGTACACGAC
GCTGCTGCTGCGTGCTGTGCGGCGCCATCGCCTCCACCACCGGGCCATTGGGCTACTGGCCTTCAGTTCGTCGGCCGGCATCATGGCGGGCTTCACGAGC
CTCGCAACCAAGTCGGCAGTCGAGATTGTCAAGTCGGCGTTGCGGGATCACCGCATTTACGAGATTGTCAATCCGTTTTTCGTGCTCATTCTCGTCGCCA
TCCCATGCGCGCTCGTTCCTCAGCTCTTCTTTCTCAACAAGGGGCTCGAGTACTTTGGCACGCTCAAGTTCATCCCGCTCTACCAGGCGTTCATTATTCT
CGGCAACATGGTCTGCGGCATGATCTTTTACAACGAGATGAGCAGCTACTCGCTGCTCGCGCTGCTCACCTTTCTCGGCGGCGTCGCGATCACGCTCTCG
GGCGTGTGTCTCTTGCTTGCCAAGGTCGACGCCGGCCATGCCAGCTCGGCCCGGGTCGGCTCGCTCTCAGAACGACAGCCGCTGCTGCCCGTGACCACGC
CCACCGCCTCCACAGCCGCTCCGCGTGCAAATGGGTCTGAGGCTCCATTCGTGACGCAGTTTCCATTTGAGGAAATGGAGTTTGCAACTGACCAAGTCGA
GACGCTCACAGACTTTGATGCGTGCAAGCAACGCATCGTCGCGCTGCTGCAATCGGCCCACAAGTCGATCTACTACTCGACCTTTCTCTGTGACTTCGAC
CAAGACCTCGTACCAGCAAGTGACCACCTCAGCAGCGTGACGTTTCTCTCGTGTCTCCAAGACGCCGCCGCGCGCGGCGTGCAGATCCATATCCTATACA
ACCCGGTCGTGGACTATGGCACGGCGTCTCTTGAGCAACTCCAGTCGCAGCTCCCACCGGGCGTCACACTGGCCTGCAGCGTGAGCGATCTCGGGCCAAG
CGTCGTCACGCAGTGTCTCTCGAACAATTCCAAGTACGCGTTCCACCACCAAAAGTACCTATGTATTGACGAGACGACTGTCATGGTCACGGGTTGCGAC
GTCAACGCCGAACGCGCTGGCTGGTTAGAGGTGAATGCCCTGGGGTACTACTGGCACGAGCTCAGCGTCGTGGCGGCCTGCAGTCCCAAAATGTTCCAGT
GGATCCGCGGGAACCACGTCCCCACGCACCACAAGCGTCACTACGACCAGTTTGTCGACGCGCCGCCGTTCCCACTCGTGGCCGGCGGCTGGCGTGAAGA
GAATGCCATGGTCAATATGATCCTAAAGGCCGAGCGGTCGATCCACTTGGAGAATCAGATTATGATCTCGGGGGGAAGCATTCAGCACAATAGGATCTGT
GAGGCACTGGTCGAGCGGGTCAGTCGTGCCCACCGAGAGAAGAAGCCGTTCCACGTGCTGCTGCTTACGAACGAAGCGCAGCAGGACGAGCCATCGCAGC
TGACGCGCACGTACTGTATGCTGTCGATCCAGTGGTCGCTCGAGCAATTGGAGAATGCGGCGAGCGAGCGTGGGCTGCCGATAGAGCTCTTGTATCAGTA
TGTTATTGTCGGGCGGCTCGCCTGCGACGGCGTGCTGGTCAAAGTGCACTCGAATATCCTTATTACGGACGGCTGGTACGCGCTACGGTCATCGTCGAAT
CTCGCCGACCGGAGTCTCAGTGCAAGGCCCACGGACACGGAGCTGGGCATCTTGGTGCAGGGCCCACAGGTCGCGCAGCTGCAGCAGTTGCTGTGGAATC
GGTACCTGCGGACAAACGAGCCGACGCCGTTGTCGATCGAGAACGTGTTTGACGCCGTGCTTCGTCCTGGAGAGGATACCACAAAGTGCTGCATTGTACC
ACTCCAGAAGAAGGCGTGGAGCCCCGTCGTCACGTGGTTCCTCATGAACCTCTTTGTGTACGGAAGCGAAGGTGCCACTGGTGGACGCGTCAAAGT