Description :
From Genome Similarity Track
Location :
Scaffold_39:84775- 86822
Transcript NameFunction/comments
Aphas_H257_11444proteolysis 6
Aphas_H257_11445putative kinesin

Sequence
2047 bases(100 bases per row)
GGGCTGTTTGTGCGGACGTGTCAGCACATTGTGCACATGAAGTGCGTCGACACGTACATGGGCACGCTGCACGAGAAGGCCATGCGCGGCGAAGAATTTG
ATGGGATGCAGGCGGTCGATGGCGACGCCCCCATGACGCAGTTCCTCTGTCCCATGTGCAAAGGCCTGTGCAACGTGTTGATTCCCATGATTCCGTCGAC
CAGTCCAGCCCCTTCCTCCTCCTCGTCCTCCTCCTCTTTGTCCACTTCTTGGTTTGACATTGTCGTCCGGCGGGACAACTCGTCGTGGATCCAACCCATG
CACCAAACACATGCAAACCAAGACACGCTGGCCAAGTGGAAACAATACTACGAAGACGCATTGTGGGAACCCCACGGTAGCTTTGAAAAGGGCGCGCCGT
ACCTGTGGTCTGCCTGCGCGTACACGGTCGCGTCGACGCTCGCGGAAGTGGATGCCCTCAACGACGACGGAAGTCGCCTCCTCTCTTGTGATGGAGACAC
AATGATGGTGTGGCCATCGACGTTGGAGAAGGAGTATGCGTCCATGCAAGCGCTCGTGACGTTTACAAGGTGGTCGTTTGCGATGGTGCACCTGACTGGC
GAATCCAAAGTTATCTACGAAACAGTCAAGCGGTGTTGCCCTGTGGTTCAAGAATCCAAGCGCGAGTACAAAAAGTACACCAAGGTACAGACTTATCTTA
TATCTATGGGCATGACAGAACTTACATGGCTGTAGATGATTGGGTCGTTGGATGCGTGCATTCGAGGAACGGTGTTAGGCTTGCTGGTTGCCGACACATT
TACGGTACACAATCATATTTGGCTTCTGGATGACAAATGTATCGTAGGCGTTTGTCGTGTCGATGGTCGCCGCCGACTCGATCGATACGATCGGCGAATT
GATTCCTGTGTTTTGCGCGGCCGACATGCTGCAGCGCCTCGGGCGTGAATTTTTCGTGTTGGAGCCGCAGCGAGCCGCCAGTTTTTACCAAGATGTGCCG
GTCTCTGCTGCTGCTCCGAACAACGGCGTTGCATCGTCGGCTCGAGGCGGCAGTCGCATGCAGACTCGTCGGGGGGGCAGTAGTGCCCCCCCTGTCGTCA
CGGCTCGCCCCCCGCAGGACCCTGCCGTGGCCCACGCCAAGAGCTTGAAATTGCTGCAACGTCACGTTGCCAAAGCCACCCGCCACTCGAAACACGCGCC
GACTCGCCGCGAGTTGCAAGCGGTCGGGGCACTGCAGTTGGTCCTGCGCCTGTGCGAAGTTGACCCGACGCTGCGGTTGAAACCCGCGGTGGACGTTGTC
GCAGTGGATGCGATTGTGGACCTGAACGCGCTGCTCGTGCGTCGAATGCATGTCGTGTACGGGTGTTTGACGGACAAATCGTTACCGTTGCCGATCCCGC
CGCCGTCGTTCCAGGACGTGAGCCAAGTGCCGCTGGACGCGCTGCAGACGATTTGGGAGTGGTGTGTGATCCGAAAAGCGTCGCAGATGGAGCTTGGGGC
GGCGTCCCAAGACGCGACCAACCGATGCGACCACGCCGAACACACGAGCGAAGCCTACTTGGCCAACATGTTTATCCTGCGCGACAACCGGACGGCGGCG
CCGCTCGAGCTGGTTGCGCTGCCGACCCAGTACGACGATCTCTACAGCCACCACGTCCGGCTCAAGTGCCAACGCTGCGACCGCGTCCCCCGAGAGCCTG
GGCTGTGCCTCGTCTGTGGCACGCTGCTCTGCTGCGGCGAGTCGTGCTGTGCGTACTCCCATGTCAAGGGCAACCCCCCCATGGGAGAGTGTACGCGCCA
CGCGTTTGAGTGCGGCGGTGGGCTTGGCGCGGTCCTGATGCTCCAGCAATGCCGCGTGGTGCTGATCGCTGGCTCCATGGTGGCCTACTTTCCAAGCCCG
TATGTGGACTCCCACGGTGAAGAAGACCCGGGGCTGCAGCGTGGGCGGCCACTCAAGCTCGACACGAACAGATACAACATGCTGCAGGCGCTGTGGCGCA
GCCATCGTCTCTATGGCGAAGTGTCTCGGCTGCGCAACCAGCGCGAC