Description :
From Genome Similarity Track
Location :
Scaffold_11:8477- 10866
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_11-fgenesh-gene-0.3Protein kinase

Sequence
2389 bases(100 bases per row)
GTCAAGGAGTTCCTGCGCCGCGCCTACAAGCTCGGTGGGCTGGCTGTGTTCCATTTCTGCCGACAATGGGAGTGCATGAACCTAACACTCGCCGTGTGCT
GCTCTTGTTAGACCCCACCTACGGTGAAGAGGCGACGCGGCTGGCGTATCAGATTGGCGTGGCGATCGCGCGCATGCACGACGCCGACATTGTGCACGGC
GACCTGACGACGTCCAACATGATGCTGAGCCACGCGGGAGCGACGGATGTGGTGCGCAGAATAGATCGCCAGTGTGTACTGTCGAGAGGTGGGAGTGAAT
TCACGGTGTGGTTGGATGGCGAGCAGACGATGATCGACTTTGGGCTCGCCAACTCTCAGCCGCTGCCGGAGGACAAGGCCGTCGACCTGTACGTCATGGA
GCGCGCTTTCGCCAGTACGCACATCAACTCGGAGCACCTGGTACGGCTTGCGTTGTGGTCCTCTGGTCGCCAACACGCTGCGGATGGTGCAGGACTGATT
CGTGATGCAATTGTCCAGGTTGCGGAGGTGCTGCGCGCTTACAAGGCGTGTTCGCGCCGCGCGGACGCCACGTTCCAGAAGCTTGCGCAGGTCCGTCTCC
GCGGCCGCAAGCGCACGATGGTCGGGTGAGTCACCCTTTCAATGCGACTCGACACCAGTTGCTCGCACTGGACGAGACAATGAATGCTGCTGCGGGACGC
AAGAGGAATGGAAGCTATCCGTGCACAGCTATATTATACGAGTGGGAACCATGTGCGAGTGGAGGCGCGTCTCCGTCACTGCCTGAGTTCGGAAACTCAA
TCAACGCTGGAGCACTCCACAGCAACCGAAATGGACTGGAGGCGACCTCCTCGTACTTCCAACGCGAGGGCTCACGCGTGCTTCTGCTTCTTGGCTGCGA
GTGCAAGCGCGTAAGCCGTCAGCAATGGTACCAAGAACCGTACACAGGCAAACGACTCCCTCACCTGGAGGCGCGTCCTCGTCCTCGTCCTCGTCGTCCT
CCTCGGCGTCCTCACCCTCGGCGTCCTCACCCTCGGCGTCCTCGTCGTCGCCGTCCTCGTTCGGCTCCGCTTCGCCGTCCTCGTCGTCCGCCGCATCATC
ATTGGCGTTCTCTTCGGCGTCCTCCTCATCGTCCTCGTCCTCGTCGTTGGCCTCGCCGTCGTCCTGGTAGTCACCGTCTTCATCGTCGTCCTGCTCCAGC
CACCAGCCACCACATTTTGCGTCAATTATCCCCACCAACTCCCCCACCACGTCGACTCTGTCGATACCCGCCAACCACCAGCATACTACCTCAAAGTTTG
TGTACAAGTAGGACAAACCGACCTCTTCCTTGCCGTTCTCGTCGCCGTCCTCGTCGCCGTCCTCGTCGCCACCGTCATCGTCCTGGTCGCCGTCGTCCGC
GGCCTCCTCCTCCTCTTCCTCATCGACTTCCTCCTCGTTCTCTCCCTCGTCCGACCCGCCGTCCGCGGCCACCGGCTCCTTCACCTTGGCGGCCTCGGCC
TTCTTGGCATTCTTATCGTCCGCGACCGCCACCTGCCAATGGCCAGTCGTGAGTGTAGCCATTCGCCCCCGCAGCTTCAACTGCCTGGAACCTCCACAGA
CAGGAACGGAGCGGCTCCACGCACCGTCATATTCGGAACCTGGATGGATACGAGGCTGGGGACTTGGTCGAAGCGCGCGAAGTGTGGGTGGGTGGGTGCA
GGTGTCTTGGGCTCAACGACAACGGACGGGCGGCGCCGACTTGCGTCGAGTGGGCTGGCTCGTAGTGTTGCACTCGGCACGAATCTTTCCATTCGGGCGA
GCGGCCAGTGTTCCGGTGCGGATTTACGTGGCAGACTCTAAATTAGCGTCGAGCGAGTACTGAAAGCGTCTGAATAGTGCTCTTTTTATCGTGCTCGAGA
GATCATGGATCGAAATCTGATTTTCGGACCATCGAGAAGGGGGTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGACGGCTCGTGGC
TCGAGCTGCAATAGAGGGGGGATGTTGCACTGTCTGGAGTATGCGGCATGAGTGTGCGTGCACGCGGTCGCGGTGGCTCTCGAGGTGCCGTTCGCTCCAG
CCGATCATGAGATACGGCCGCGTGATTTTGATCCATAATGAGCCGCCTGCGCCAAGATCTCTCGAAATTCATAACGAGCCAGTCGAATCGTCAGCCAAGA
CGCGGCTCCAGCTGGTTCTGCTGTTGCTGGAGCAGGAGGATCTCTAAATTTGTATCTGTGCGCGGCCACCCCTGGCCCTCCTCAAACTGCGAGGTCAACA
AATCCACAACCCTTCCCGGCACACCTCGCCTCACCAATTGCAGTATCTCGTTGTGCTCTCCATAGCTTCATAAAAACCATGCACTGTTT